EMAIL THIS PAGE TO A FRIEND

DNAJC12

DnaJ (Hsp40) homolog, subfamily C, member 12

103 Gene Product Result for
Synonyms: JDP1
UniProtKB ID: Q9UKB3, Q5JVQ1, Q9UKB2
Gene ID:
Human(56521) Summary: This gene encodes a member of a subclass of the HSP40/DnaJ protein family. Members of this family of proteins are associated with complex assembly, protein folding, and export. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(30045) DnaJ (Hsp40) homolog, subfamily C, member 12
Rat(619393) DnaJ (Hsp40) homolog, subfamily C, member 12
naked mole-rat(101725250) DnaJ (Hsp40) homolog, subfamily C, member 12
domestic guinea pig(100730282) DnaJ (Hsp40) homolog, subfamily C, member 12
Goat(100861352) DnaJ (Hsp40) homolog, subfamily C, member 12
sheep(101102697) DnaJ (Hsp40) homolog, subfamily C, member 12
Zebrafish(797196) DnaJ (Hsp40) homolog, subfamily C, member 12
chicken(423647) DnaJ (Hsp40) homolog, subfamily C, member 12
dog(479224) DnaJ (Hsp40) homolog, subfamily C, member 12
cow(281259) DnaJ (Hsp40) homolog, subfamily C, member 12
domestic cat(101087352) DnaJ (Hsp40) homolog, subfamily C, member 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021800 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021800 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021800 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021800 Rosetta Predictions human pricing
NM_201262 Rosetta Predictions human pricing
NM_001034032 Rosetta Predictions rat pricing
NM_013888 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167468 predicted 351
2 SASI_Hs01_00167469 predicted 197
3 SASI_Hs02_00355101 predicted 436
4 SASI_Hs01_00167471 predicted 734
5 SASI_Hs01_00167472 predicted 506
6 SASI_Hs01_00167473 predicted 214
7 SASI_Hs01_00167474 predicted 523
8 SASI_Hs01_00167475 predicted 453
9 SASI_Hs01_00167476 predicted 708
10 SASI_Hs01_00167477 predicted 735
11 SASI_Hs01_00167470 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080735 predicted 343
2 SASI_Hs01_00080736 predicted 202
3 SASI_Hs01_00080737 predicted 509
4 SASI_Hs01_00080738 predicted 216
5 SASI_Hs01_00080740 predicted 445
6 SASI_Hs01_00080741 predicted 209
7 SASI_Hs02_00372906 predicted 494
8 SASI_Hs01_00080742 predicted 533
9 SASI_Hs01_00080743 predicted 520
10 SASI_Hs01_00080744 predicted 510
11 SASI_Hs01_00080739 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045631 predicted 330
2 SASI_Rn01_00045632 predicted 745
3 SASI_Rn01_00045633 predicted 824
4 SASI_Rn01_00045634 predicted 868
5 SASI_Rn01_00045635 predicted 867
6 SASI_Rn01_00045637 predicted 755
7 SASI_Rn01_00045638 predicted 590
8 SASI_Rn01_00045639 predicted 905
9 SASI_Rn01_00045640 predicted 213
10 SASI_Rn02_00203910 predicted 385
11 SASI_Rn01_00045636 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095111 predicted 645
2 SASI_Mm01_00095112 predicted 921
3 SASI_Mm01_00095113 predicted 760
4 SASI_Mm01_00095114 predicted 731
5 SASI_Mm01_00095115 predicted 912
6 SASI_Mm01_00095116 predicted 890
7 SASI_Mm02_00322935 predicted 869
8 SASI_Mm01_00095117 predicted 857
9 SASI_Mm01_00095118 predicted 649
10 SASI_Mm01_00095119 predicted 918
11 SASI_Mm01_00095110 predicted 811
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013888
VALIDATED
DNAJC12 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013888.2-396s21c1
Sequence:CCGGCAGAAGTAAGAAGGACTTGATCTCGAGATCAAGTCCTTCTTACTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013888.2-160s21c1
Sequence:CCGGGTTGAGCAAATCTTGGCAGAACTCGAGTTCTGCCAAGATTTGCTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013888.2-652s21c1
Sequence:CCGGCGGAAGTTCAGAAACTATGAACTCGAGTTCATAGTTTCTGAACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013888.2-870s21c1
Sequence:CCGGGCTCTGTATCATTGATTCTTACTCGAGTAAGAATCAATGATACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013888.1-651s1c1
Sequence:CCGGCCTGCGGAAGTTCAGAAACTACTCGAGTAGTTTCTGAACTTCCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013888.1-655s1c1
Sequence:CCGGCGGAAGTTCAGAAACTATGAACTCGAGTTCATAGTTTCTGAACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013888.1-873s1c1
Sequence:CCGGGCTCTGTATCATTGATTCTTACTCGAGTAAGAATCAATGATACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013888.1-163s1c1
Sequence:CCGGGTTGAGCAAATCTTGGCAGAACTCGAGTTCTGCCAAGATTTGCTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013888.1-399s1c1
Sequence:CCGGCAGAAGTAAGAAGGACTTGATCTCGAGATCAAGTCCTTCTTACTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013888
VALIDATED
DNAJC12 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013888.2-396s21c1
Sequence:CCGGCAGAAGTAAGAAGGACTTGATCTCGAGATCAAGTCCTTCTTACTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013888.2-160s21c1
Sequence:CCGGGTTGAGCAAATCTTGGCAGAACTCGAGTTCTGCCAAGATTTGCTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013888.2-652s21c1
Sequence:CCGGCGGAAGTTCAGAAACTATGAACTCGAGTTCATAGTTTCTGAACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013888.2-870s21c1
Sequence:CCGGGCTCTGTATCATTGATTCTTACTCGAGTAAGAATCAATGATACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013888.1-651s1c1
Sequence:CCGGCCTGCGGAAGTTCAGAAACTACTCGAGTAGTTTCTGAACTTCCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013888.1-655s1c1
Sequence:CCGGCGGAAGTTCAGAAACTATGAACTCGAGTTCATAGTTTCTGAACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013888.1-873s1c1
Sequence:CCGGGCTCTGTATCATTGATTCTTACTCGAGTAAGAATCAATGATACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013888.1-163s1c1
Sequence:CCGGGTTGAGCAAATCTTGGCAGAACTCGAGTTCTGCCAAGATTTGCTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013888.1-399s1c1
Sequence:CCGGCAGAAGTAAGAAGGACTTGATCTCGAGATCAAGTCCTTCTTACTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013888
VALIDATED
DNAJC12 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013888.2-396s21c1
Sequence:CCGGCAGAAGTAAGAAGGACTTGATCTCGAGATCAAGTCCTTCTTACTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013888.2-160s21c1
Sequence:CCGGGTTGAGCAAATCTTGGCAGAACTCGAGTTCTGCCAAGATTTGCTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013888.2-652s21c1
Sequence:CCGGCGGAAGTTCAGAAACTATGAACTCGAGTTCATAGTTTCTGAACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318128    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013888.2-870s21c1
Sequence:CCGGGCTCTGTATCATTGATTCTTACTCGAGTAAGAATCAATGATACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013888.1-651s1c1
Sequence:CCGGCCTGCGGAAGTTCAGAAACTACTCGAGTAGTTTCTGAACTTCCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013888.1-655s1c1
Sequence:CCGGCGGAAGTTCAGAAACTATGAACTCGAGTTCATAGTTTCTGAACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013888.1-873s1c1
Sequence:CCGGGCTCTGTATCATTGATTCTTACTCGAGTAAGAATCAATGATACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013888.1-163s1c1
Sequence:CCGGGTTGAGCAAATCTTGGCAGAACTCGAGTTCTGCCAAGATTTGCTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013888.1-399s1c1
Sequence:CCGGCAGAAGTAAGAAGGACTTGATCTCGAGATCAAGTCCTTCTTACTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021800
VALIDATED
DNAJC12 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_021800.2-224s21c1
Sequence:CCGGTGGGATGTGATGAACTATCTTCTCGAGAAGATAGTTCATCACATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021800.2-585s21c1
Sequence:CCGGGCTGGCTTCAACCGCAGAGAACTCGAGTTCTCTGCGGTTGAAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021800.2-352s21c1
Sequence:CCGGGCAAAGGAGATTCTGACCAATCTCGAGATTGGTCAGAATCTCCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_021800.2-741s21c1
Sequence:CCGGGAAGTTCAGAAACTATGAAATCTCGAGATTTCATAGTTTCTGAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_021800.2-868s21c1
Sequence:CCGGTGTGAATTGCTGAGTACTAATCTCGAGATTAGTACTCAGCAATTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_021800.2-823s1c1
Sequence:CCGGGCAGTCTTTGTTTATGTCTTACTCGAGTAAGACATAAACAAAGACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021800.2-352s1c1
Sequence:CCGGGCAAAGGAGATTCTGACCAATCTCGAGATTGGTCAGAATCTCCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021800.2-585s1c1
Sequence:CCGGGCTGGCTTCAACCGCAGAGAACTCGAGTTCTCTGCGGTTGAAGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_021800.2-224s1c1
Sequence:CCGGTGGGATGTGATGAACTATCTTCTCGAGAAGATAGTTCATCACATCCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021800.2-508s1c1
Sequence:CCGGGAAGAATCTGACAAGACTCATCTCGAGATGAGTCTTGTCAGATTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021800
VALIDATED
DNAJC12 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_021800.2-224s21c1
Sequence:CCGGTGGGATGTGATGAACTATCTTCTCGAGAAGATAGTTCATCACATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021800.2-585s21c1
Sequence:CCGGGCTGGCTTCAACCGCAGAGAACTCGAGTTCTCTGCGGTTGAAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021800.2-352s21c1
Sequence:CCGGGCAAAGGAGATTCTGACCAATCTCGAGATTGGTCAGAATCTCCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_021800.2-741s21c1
Sequence:CCGGGAAGTTCAGAAACTATGAAATCTCGAGATTTCATAGTTTCTGAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_021800.2-868s21c1
Sequence:CCGGTGTGAATTGCTGAGTACTAATCTCGAGATTAGTACTCAGCAATTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_021800.2-823s1c1
Sequence:CCGGGCAGTCTTTGTTTATGTCTTACTCGAGTAAGACATAAACAAAGACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021800.2-352s1c1
Sequence:CCGGGCAAAGGAGATTCTGACCAATCTCGAGATTGGTCAGAATCTCCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021800.2-585s1c1
Sequence:CCGGGCTGGCTTCAACCGCAGAGAACTCGAGTTCTCTGCGGTTGAAGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_021800.2-224s1c1
Sequence:CCGGTGGGATGTGATGAACTATCTTCTCGAGAAGATAGTTCATCACATCCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021800.2-508s1c1
Sequence:CCGGGAAGAATCTGACAAGACTCATCTCGAGATGAGTCTTGTCAGATTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021800
VALIDATED
DNAJC12 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_021800.2-224s21c1
Sequence:CCGGTGGGATGTGATGAACTATCTTCTCGAGAAGATAGTTCATCACATCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021800.2-585s21c1
Sequence:CCGGGCTGGCTTCAACCGCAGAGAACTCGAGTTCTCTGCGGTTGAAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021800.2-352s21c1
Sequence:CCGGGCAAAGGAGATTCTGACCAATCTCGAGATTGGTCAGAATCTCCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_021800.2-741s21c1
Sequence:CCGGGAAGTTCAGAAACTATGAAATCTCGAGATTTCATAGTTTCTGAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273887    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_021800.2-868s21c1
Sequence:CCGGTGTGAATTGCTGAGTACTAATCTCGAGATTAGTACTCAGCAATTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_021800.2-823s1c1
Sequence:CCGGGCAGTCTTTGTTTATGTCTTACTCGAGTAAGACATAAACAAAGACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021800.2-352s1c1
Sequence:CCGGGCAAAGGAGATTCTGACCAATCTCGAGATTGGTCAGAATCTCCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_021800.2-585s1c1
Sequence:CCGGGCTGGCTTCAACCGCAGAGAACTCGAGTTCTCTGCGGTTGAAGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_021800.2-224s1c1
Sequence:CCGGTGGGATGTGATGAACTATCTTCTCGAGAAGATAGTTCATCACATCCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021800.2-508s1c1
Sequence:CCGGGAAGAATCTGACAAGACTCATCTCGAGATGAGTCTTGTCAGATTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)