EMAIL THIS PAGE TO A FRIEND

DNAJC13

DnaJ (Hsp40) homolog, subfamily C, member 13

123 Gene Product Result for
Synonyms: RME8
Gene ID:
Mouse(235567) DnaJ (Hsp40) homolog, subfamily C, member 13
Rat(363127) DnaJ (Hsp40) homolog, subfamily C, member 13
chicken(420688) DnaJ (Hsp40) homolog, subfamily C, member 13
cow(504472) DnaJ (Hsp40) homolog, subfamily C, member 13
domestic cat(101089388) DnaJ (Hsp40) homolog, subfamily C, member 13
dog(485663) DnaJ (Hsp40) homolog, subfamily C, member 13
sheep(101119603) DnaJ (Hsp40) homolog, subfamily C, member 13
Domestic Rabbit(100352461) DnaJ (Hsp40) homolog, subfamily C, member 13
domestic guinea pig(100726047) DnaJ (Hsp40) homolog, subfamily C, member 13
naked mole-rat(101719278) DnaJ (Hsp40) homolog, subfamily C, member 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015268 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015268 Rosetta Predictions human pricing
NM_001108776 Rosetta Predictions rat pricing
XM_001475053 Rosetta Predictions mouse pricing
XM_135146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074783 predicted 1023
2 SASI_Hs02_00347421 predicted 6066
3 SASI_Hs01_00074784 predicted 6589
4 SASI_Hs02_00347422 predicted 2547
5 SASI_Hs02_00347423 predicted 3136
6 SASI_Hs01_00074786 predicted 580
7 SASI_Hs01_00074787 predicted 3786
8 SASI_Hs01_00074788 predicted 2593
9 SASI_Hs01_00074789 predicted 6523
10 SASI_Hs01_00074790 predicted 4565
11 SASI_Hs01_00074785 predicted 3929
12 SASI_Hs01_00074791 predicted 6244
13 SASI_Hs01_00074792 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241965 predicted 3889
2 SASI_Rn02_00241966 predicted 4624
3 SASI_Rn02_00241967 predicted 2815
4 SASI_Rn02_00241968 predicted 1483
5 SASI_Rn02_00241969 predicted 3730
6 SASI_Rn02_00241970 predicted 818
7 SASI_Rn02_00241971 predicted 844
8 SASI_Rn02_00241972 predicted 2756
9 SASI_Rn02_00241973 predicted 5061
10 SASI_Rn02_00241974 predicted 3840
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001475053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00379805 predicted 1192
2 SASI_Mm02_00379806 predicted 910
3 SASI_Mm02_00379807 predicted 1361
4 SASI_Mm02_00379808 predicted 722
5 SASI_Mm02_00379809 predicted 1410
6 SASI_Mm02_00379810 predicted 1028
7 SASI_Mm02_00379811 predicted 1396
8 SASI_Mm02_00379812 predicted 1235
9 SASI_Mm02_00379813 predicted 1252
10 SASI_Mm02_00379814 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266260 predicted 4925
2 SASI_Mm01_00266261 predicted 4464
3 SASI_Mm01_00266262 predicted 7110
4 SASI_Mm01_00266263 predicted 721
5 SASI_Mm01_00266264 predicted 1098
6 SASI_Mm01_00266265 predicted 1803
7 SASI_Mm01_00266266 predicted 6708
8 SASI_Mm01_00266267 predicted 3329
9 SASI_Mm01_00266268 predicted 3211
10 SASI_Mm01_00266269 predicted 1485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015268
VALIDATED
DNAJC13 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 13
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000146708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015268.1-492s1c1
Sequence:CCGGCACGAGAAGAACTGAAAGATACTCGAGTATCTTTCAGTTCTTCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015268.1-1505s1c1
Sequence:CCGGCGCCTTTATCTGAGTGGAGTACTCGAGTACTCCACTCAGATAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015268.3-1903s21c1
Sequence:CCGGACTTGCATACTGCGATGTTTACTCGAGTAAACATCGCAGTATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015268.3-5728s21c1
Sequence:CCGGTAGGTCCAAAGGTTCGAATTACTCGAGTAATTCGAACCTTTGGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015268.3-858s21c1
Sequence:CCGGCGTGATCCGGCAACCTATAATCTCGAGATTATAGGTTGCCGGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015268.3-6952s21c1
Sequence:CCGGGATCCTAATTGTATCACATTACTCGAGTAATGTGATACAATTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015268.3-4824s21c1
Sequence:CCGGAGTCGCCTTGGAGGGTATTTGCTCGAGCAAATACCCTCCAAGGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015268
VALIDATED
DNAJC13 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 13
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000146708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015268.1-492s1c1
Sequence:CCGGCACGAGAAGAACTGAAAGATACTCGAGTATCTTTCAGTTCTTCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015268.1-1505s1c1
Sequence:CCGGCGCCTTTATCTGAGTGGAGTACTCGAGTACTCCACTCAGATAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015268.3-1903s21c1
Sequence:CCGGACTTGCATACTGCGATGTTTACTCGAGTAAACATCGCAGTATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015268.3-5728s21c1
Sequence:CCGGTAGGTCCAAAGGTTCGAATTACTCGAGTAATTCGAACCTTTGGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015268.3-858s21c1
Sequence:CCGGCGTGATCCGGCAACCTATAATCTCGAGATTATAGGTTGCCGGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015268.3-6952s21c1
Sequence:CCGGGATCCTAATTGTATCACATTACTCGAGTAATGTGATACAATTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015268.3-4824s21c1
Sequence:CCGGAGTCGCCTTGGAGGGTATTTGCTCGAGCAAATACCCTCCAAGGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015268
VALIDATED
DNAJC13 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 13
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000146708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015268.1-492s1c1
Sequence:CCGGCACGAGAAGAACTGAAAGATACTCGAGTATCTTTCAGTTCTTCTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015268.1-1505s1c1
Sequence:CCGGCGCCTTTATCTGAGTGGAGTACTCGAGTACTCCACTCAGATAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015268.3-1903s21c1
Sequence:CCGGACTTGCATACTGCGATGTTTACTCGAGTAAACATCGCAGTATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015268.3-5728s21c1
Sequence:CCGGTAGGTCCAAAGGTTCGAATTACTCGAGTAATTCGAACCTTTGGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015268.3-858s21c1
Sequence:CCGGCGTGATCCGGCAACCTATAATCTCGAGATTATAGGTTGCCGGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015268.3-6952s21c1
Sequence:CCGGGATCCTAATTGTATCACATTACTCGAGTAATGTGATACAATTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015268.3-4824s21c1
Sequence:CCGGAGTCGCCTTGGAGGGTATTTGCTCGAGCAAATACCCTCCAAGGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks