EMAIL THIS PAGE TO A FRIEND

DNAJC14

DnaJ (Hsp40) homolog, subfamily C, member 14

101 Gene Product Result for
Synonyms: DNAJ DRIP78 HDJ3 LIP6
UniProtKB ID: Q6Y2X3, A5YM67, Q17RY2, Q66K17, Q96N59, Q96T63
Gene ID:
Mouse(74330) DnaJ (Hsp40) homolog, subfamily C, member 14
Rat(114481) DnaJ (Hsp40) homolog, subfamily C, member 14
naked mole-rat(101697565) DnaJ (Hsp40) homolog, subfamily C, member 14
domestic guinea pig(100715915) DnaJ (Hsp40) homolog, subfamily C, member 14
sheep(101114181) DnaJ (Hsp40) homolog, subfamily C, member 14
chicken(428488) DnaJ (Hsp40) homolog, subfamily C, member 14
domestic cat(101091793) DnaJ (Hsp40) homolog, subfamily C, member 14
cow(281691) DnaJ (Hsp40) homolog, subfamily C, member 14
dog(100688632) DnaJ (Hsp40) homolog, subfamily C, member 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032364 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032364 Rosetta Predictions human pricing
NM_053690 Rosetta Predictions rat pricing
NM_028873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187750 predicted 1872
2 SASI_Hs01_00187748 predicted 873
3 SASI_Hs01_00187749 predicted 1587
4 SASI_Hs02_00359748 predicted 228
5 SASI_Hs02_00359749 predicted 1557
6 SASI_Hs01_00187751 predicted 891
7 SASI_Hs01_00187752 predicted 989
8 SASI_Hs01_00187753 predicted 1836
9 SASI_Hs01_00187754 predicted 286
10 SASI_Hs01_00187755 predicted 1972
11 SASI_Hs01_00187746 predicted 1200
12 SASI_Hs01_00187747 predicted 1784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086828 predicted 2000
2 SASI_Rn02_00266447 predicted 1350
3 SASI_Rn02_00266448 predicted 1008
4 SASI_Rn01_00086834 predicted 386
5 SASI_Rn02_00266449 predicted 415
6 SASI_Rn01_00086836 predicted 920
7 SASI_Rn01_00086837 predicted 906
8 SASI_Rn02_00266450 predicted 1467
9 SASI_Rn02_00266451 predicted 284
10 SASI_Rn02_00266452 predicted 1958
11 SASI_Rn01_00086829 predicted 334
12 SASI_Rn01_00086830 predicted 875
13 SASI_Rn01_00086831 predicted 884
14 SASI_Rn01_00086832 predicted 1540
15 SASI_Rn01_00086833 predicted 219
16 SASI_Rn01_00086835 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032523 predicted 1476
2 SASI_Mm01_00032524 predicted 1753
3 SASI_Mm01_00032525 predicted 2116
4 SASI_Mm01_00032526 predicted 1177
5 SASI_Mm01_00032527 predicted 1468
6 SASI_Mm01_00032528 predicted 1244
7 SASI_Mm01_00032529 predicted 1715
8 SASI_Mm01_00032530 predicted 1745
9 SASI_Mm01_00032531 predicted 691
10 SASI_Mm01_00032532 predicted 1311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032364
VALIDATED
DNAJC14 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 14
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032364.5-2138s21c1
Sequence:CCGGATTTCTTGAGTCGGATCTTTCCTCGAGGAAAGATCCGACTCAAGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032364.5-879s21c1
Sequence:CCGGGAAACGAAGTCAGGCAGATAACTCGAGTTATCTGCCTGACTTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032364.4-842s1c1
Sequence:CCGGGCCGAGGAACTATGTCAACTTCTCGAGAAGTTGACATAGTTCCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032364.4-1799s1c1
Sequence:CCGGGCTGAGTGTAATAGGCTGCATCTCGAGATGCAGCCTATTACACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032364.4-617s1c1
Sequence:CCGGGAGTTGGAAGAGGAATATGATCTCGAGATCATATTCCTCTTCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032364.4-1619s1c1
Sequence:CCGGCGAAAGGAGTATGAGATGAAACTCGAGTTTCATCTCATACTCCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032364.4-1968s1c1
Sequence:CCGGCCTATCACATCTCATTTGGTTCTCGAGAACCAAATGAGATGTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032364.4-1324s1c1
Sequence:CCGGGCCTTGGGTCAAGCAGAATATCTCGAGATATTCTGCTTGACCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032364
VALIDATED
DNAJC14 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 14
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032364.5-2138s21c1
Sequence:CCGGATTTCTTGAGTCGGATCTTTCCTCGAGGAAAGATCCGACTCAAGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032364.5-879s21c1
Sequence:CCGGGAAACGAAGTCAGGCAGATAACTCGAGTTATCTGCCTGACTTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032364.4-842s1c1
Sequence:CCGGGCCGAGGAACTATGTCAACTTCTCGAGAAGTTGACATAGTTCCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032364.4-1799s1c1
Sequence:CCGGGCTGAGTGTAATAGGCTGCATCTCGAGATGCAGCCTATTACACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032364.4-617s1c1
Sequence:CCGGGAGTTGGAAGAGGAATATGATCTCGAGATCATATTCCTCTTCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032364.4-1619s1c1
Sequence:CCGGCGAAAGGAGTATGAGATGAAACTCGAGTTTCATCTCATACTCCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032364.4-1968s1c1
Sequence:CCGGCCTATCACATCTCATTTGGTTCTCGAGAACCAAATGAGATGTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032364.4-1324s1c1
Sequence:CCGGGCCTTGGGTCAAGCAGAATATCTCGAGATATTCTGCTTGACCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032364
VALIDATED
DNAJC14 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 14
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032364.5-2138s21c1
Sequence:CCGGATTTCTTGAGTCGGATCTTTCCTCGAGGAAAGATCCGACTCAAGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032364.5-879s21c1
Sequence:CCGGGAAACGAAGTCAGGCAGATAACTCGAGTTATCTGCCTGACTTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032364.4-842s1c1
Sequence:CCGGGCCGAGGAACTATGTCAACTTCTCGAGAAGTTGACATAGTTCCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032364.4-1799s1c1
Sequence:CCGGGCTGAGTGTAATAGGCTGCATCTCGAGATGCAGCCTATTACACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032364.4-617s1c1
Sequence:CCGGGAGTTGGAAGAGGAATATGATCTCGAGATCATATTCCTCTTCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032364.4-1619s1c1
Sequence:CCGGCGAAAGGAGTATGAGATGAAACTCGAGTTTCATCTCATACTCCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032364.4-1968s1c1
Sequence:CCGGCCTATCACATCTCATTTGGTTCTCGAGAACCAAATGAGATGTGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032364.4-1324s1c1
Sequence:CCGGGCCTTGGGTCAAGCAGAATATCTCGAGATATTCTGCTTGACCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028873
VALIDATED
DNAJC14 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 14
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028873.4-1247s21c1
Sequence:CCGGCAGCAGCTGGTAAGGTTAATACTCGAGTATTAACCTTACCAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028873.4-2895s21c1
Sequence:CCGGGCCAGGAGATTATCTTTCTATCTCGAGATAGAAAGATAATCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028873.4-1456s21c1
Sequence:CCGGTGAACTAAAGAAGGCCTATAGCTCGAGCTATAGGCCTTCTTTAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028873.4-1582s21c1
Sequence:CCGGGCGGAAGGAATATGAGATGAACTCGAGTTCATCTCATATTCCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028873.4-600s21c1
Sequence:CCGGATGATGAGGAACCTCTTAAATCTCGAGATTTAAGAGGTTCCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028873.2-612s1c1
Sequence:CCGGCCTCTTAAATTTCCCAGTGATCTCGAGATCACTGGGAAATTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028873.2-1584s1c1
Sequence:CCGGCGGAAGGAATATGAGATGAAACTCGAGTTTCATCTCATATTCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028873.2-1583s1c1
Sequence:CCGGGCGGAAGGAATATGAGATGAACTCGAGTTCATCTCATATTCCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028873.2-2896s1c1
Sequence:CCGGGCCAGGAGATTATCTTTCTATCTCGAGATAGAAAGATAATCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028873.2-990s1c1
Sequence:CCGGGCCCGCATGATGTTCCAGTTTCTCGAGAAACTGGAACATCATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028873
VALIDATED
DNAJC14 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 14
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028873.4-1247s21c1
Sequence:CCGGCAGCAGCTGGTAAGGTTAATACTCGAGTATTAACCTTACCAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028873.4-2895s21c1
Sequence:CCGGGCCAGGAGATTATCTTTCTATCTCGAGATAGAAAGATAATCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028873.4-1456s21c1
Sequence:CCGGTGAACTAAAGAAGGCCTATAGCTCGAGCTATAGGCCTTCTTTAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028873.4-1582s21c1
Sequence:CCGGGCGGAAGGAATATGAGATGAACTCGAGTTCATCTCATATTCCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028873.4-600s21c1
Sequence:CCGGATGATGAGGAACCTCTTAAATCTCGAGATTTAAGAGGTTCCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028873.2-612s1c1
Sequence:CCGGCCTCTTAAATTTCCCAGTGATCTCGAGATCACTGGGAAATTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028873.2-1584s1c1
Sequence:CCGGCGGAAGGAATATGAGATGAAACTCGAGTTTCATCTCATATTCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028873.2-1583s1c1
Sequence:CCGGGCGGAAGGAATATGAGATGAACTCGAGTTCATCTCATATTCCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028873.2-2896s1c1
Sequence:CCGGGCCAGGAGATTATCTTTCTATCTCGAGATAGAAAGATAATCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028873.2-990s1c1
Sequence:CCGGGCCCGCATGATGTTCCAGTTTCTCGAGAAACTGGAACATCATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028873
VALIDATED
DNAJC14 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 14
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028873.4-1247s21c1
Sequence:CCGGCAGCAGCTGGTAAGGTTAATACTCGAGTATTAACCTTACCAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028873.4-2895s21c1
Sequence:CCGGGCCAGGAGATTATCTTTCTATCTCGAGATAGAAAGATAATCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028873.4-1456s21c1
Sequence:CCGGTGAACTAAAGAAGGCCTATAGCTCGAGCTATAGGCCTTCTTTAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028873.4-1582s21c1
Sequence:CCGGGCGGAAGGAATATGAGATGAACTCGAGTTCATCTCATATTCCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028873.4-600s21c1
Sequence:CCGGATGATGAGGAACCTCTTAAATCTCGAGATTTAAGAGGTTCCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028873.2-612s1c1
Sequence:CCGGCCTCTTAAATTTCCCAGTGATCTCGAGATCACTGGGAAATTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028873.2-1584s1c1
Sequence:CCGGCGGAAGGAATATGAGATGAAACTCGAGTTTCATCTCATATTCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028873.2-1583s1c1
Sequence:CCGGGCGGAAGGAATATGAGATGAACTCGAGTTCATCTCATATTCCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028873.2-2896s1c1
Sequence:CCGGGCCAGGAGATTATCTTTCTATCTCGAGATAGAAAGATAATCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028873.2-990s1c1
Sequence:CCGGGCCCGCATGATGTTCCAGTTTCTCGAGAAACTGGAACATCATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks