EMAIL THIS PAGE TO A FRIEND

DNAJC15

DnaJ (Hsp40) homolog, subfamily C, member 15

97 Gene Product Result for
Synonyms: DNAJD1 HSD18 MCJ
UniProtKB ID: Q9Y5T4, B2R4L0, Q5T219, Q6X963
Gene ID:
Mouse(66148) DnaJ (Hsp40) homolog, subfamily C, member 15
Rat(290370) DnaJ (Hsp40) homolog, subfamily C, member 15
Zebrafish(445082) DnaJ (Hsp40) homolog, subfamily C, member 15
chicken(418838) DnaJ (Hsp40) homolog, subfamily C, member 15
cow(618047) DnaJ (Hsp40) homolog, subfamily C, member 15
domestic cat(101087037) DnaJ (Hsp40) homolog, subfamily C, member 15
dog(476930) DnaJ (Hsp40) homolog, subfamily C, member 15
sheep(101102071) DnaJ (Hsp40) homolog, subfamily C, member 15
domestic guinea pig(100713779) DnaJ (Hsp40) homolog, subfamily C, member 15
naked mole-rat(101724274) DnaJ (Hsp40) homolog, subfamily C, member 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025384 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025384 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025384 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013238 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013238 Rosetta Predictions human pricing
NM_001106050 Rosetta Predictions rat pricing
NM_025384 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246981 predicted 553
2 SASI_Hs01_00246982 predicted 536
3 SASI_Hs02_00344433 predicted 427
4 SASI_Hs02_00344434 predicted 502
5 SASI_Hs01_00246984 predicted 572
6 SASI_Hs01_00246985 predicted 576
7 SASI_Hs01_00246983 predicted 489
8 SASI_Hs01_00246986 predicted 960
9 SASI_Hs01_00246987 predicted 1037
10 SASI_Hs01_00246988 predicted 1202
11 SASI_Hs01_00246989 predicted 1189
12 SASI_Hs01_00246990 predicted 1338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215132 predicted 519
2 SASI_Rn02_00215133 predicted 426
3 SASI_Rn02_00215134 predicted 324
4 SASI_Rn02_00215135 predicted 197
5 SASI_Rn02_00215136 predicted 532
6 SASI_Rn02_00215137 predicted 540
7 SASI_Rn02_00215138 predicted 526
8 SASI_Rn02_00215139 predicted 464
9 SASI_Rn02_00215140 predicted 347
10 SASI_Rn02_00215141 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188139 predicted 284
2 SASI_Mm01_00188141 predicted 351
3 SASI_Mm01_00188142 predicted 351
4 SASI_Mm01_00188143 predicted 338
5 SASI_Mm02_00328116 predicted 385
6 SASI_Mm01_00188145 predicted 325
7 SASI_Mm01_00188146 predicted 329
8 SASI_Mm01_00188147 predicted 351
9 SASI_Mm01_00188148 predicted 390
10 SASI_Mm02_00328117 predicted 338
11 SASI_Mm01_00188140 predicted 289
12 SASI_Mm01_00188144 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025384
VALIDATED
DNAJC15 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 15
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025384.3-160s1c1
Sequence:CCGGGTTGCATTTGCAGGTCGCTATCTCGAGATAGCGACCTGCAAATGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025384.3-477s1c1
Sequence:CCGGGACTGTACATACCGAGGGAAACTCGAGTTTCCCTCGGTATGTACAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025384.3-400s1c1
Sequence:CCGGTCTCCTTACTTAGCATCCAAACTCGAGTTTGGATGCTAAGTAAGGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025384.3-355s1c1
Sequence:CCGGGCACACAAGAGAATTATGATTCTCGAGAATCATAATTCTCTTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025384.3-254s1c1
Sequence:CCGGCATCCTACTATAAAGGAGGATCTCGAGATCCTCCTTTATAGTAGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-455s21c1
Sequence:CCGGGCAAAGCTAACTGATGCTAAACTCGAGTTTAGCATCAGTTAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-377s21c1
Sequence:CCGGTAAACCATCCAGACAAAGGTGCTCGAGCACCTTTGTCTGGATGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025384.3-501s21c1
Sequence:CCGGGAACAAACGCACAGCTGTAAACTCGAGTTTACAGCTGTGCGTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-64s21c1
Sequence:CCGGGCCGAATACCTGCCTCCTTCTCTCGAGAGAAGGAGGCAGGTATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-187s21c1
Sequence:CCGGCAGATCTGGAAACCTCTAGAACTCGAGTTCTAGAGGTTTCCAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-210s21c1
Sequence:CCGGAGTAATCACGGCAACAGCAAGCTCGAGCTTGCTGTTGCCGTGATTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-291s21c1
Sequence:CCGGTAAGCGAGAGGCTAGTCTTATCTCGAGATAAGACTAGCCTCTCGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025384
VALIDATED
DNAJC15 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 15
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025384.3-160s1c1
Sequence:CCGGGTTGCATTTGCAGGTCGCTATCTCGAGATAGCGACCTGCAAATGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025384.3-477s1c1
Sequence:CCGGGACTGTACATACCGAGGGAAACTCGAGTTTCCCTCGGTATGTACAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025384.3-400s1c1
Sequence:CCGGTCTCCTTACTTAGCATCCAAACTCGAGTTTGGATGCTAAGTAAGGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025384.3-355s1c1
Sequence:CCGGGCACACAAGAGAATTATGATTCTCGAGAATCATAATTCTCTTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025384.3-254s1c1
Sequence:CCGGCATCCTACTATAAAGGAGGATCTCGAGATCCTCCTTTATAGTAGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-455s21c1
Sequence:CCGGGCAAAGCTAACTGATGCTAAACTCGAGTTTAGCATCAGTTAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-377s21c1
Sequence:CCGGTAAACCATCCAGACAAAGGTGCTCGAGCACCTTTGTCTGGATGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025384.3-501s21c1
Sequence:CCGGGAACAAACGCACAGCTGTAAACTCGAGTTTACAGCTGTGCGTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-64s21c1
Sequence:CCGGGCCGAATACCTGCCTCCTTCTCTCGAGAGAAGGAGGCAGGTATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-187s21c1
Sequence:CCGGCAGATCTGGAAACCTCTAGAACTCGAGTTCTAGAGGTTTCCAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-210s21c1
Sequence:CCGGAGTAATCACGGCAACAGCAAGCTCGAGCTTGCTGTTGCCGTGATTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-291s21c1
Sequence:CCGGTAAGCGAGAGGCTAGTCTTATCTCGAGATAAGACTAGCCTCTCGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025384
VALIDATED
DNAJC15 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 15
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025384.3-160s1c1
Sequence:CCGGGTTGCATTTGCAGGTCGCTATCTCGAGATAGCGACCTGCAAATGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025384.3-477s1c1
Sequence:CCGGGACTGTACATACCGAGGGAAACTCGAGTTTCCCTCGGTATGTACAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025384.3-400s1c1
Sequence:CCGGTCTCCTTACTTAGCATCCAAACTCGAGTTTGGATGCTAAGTAAGGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025384.3-355s1c1
Sequence:CCGGGCACACAAGAGAATTATGATTCTCGAGAATCATAATTCTCTTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025384.3-254s1c1
Sequence:CCGGCATCCTACTATAAAGGAGGATCTCGAGATCCTCCTTTATAGTAGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-455s21c1
Sequence:CCGGGCAAAGCTAACTGATGCTAAACTCGAGTTTAGCATCAGTTAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-377s21c1
Sequence:CCGGTAAACCATCCAGACAAAGGTGCTCGAGCACCTTTGTCTGGATGGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025384.3-501s21c1
Sequence:CCGGGAACAAACGCACAGCTGTAAACTCGAGTTTACAGCTGTGCGTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-64s21c1
Sequence:CCGGGCCGAATACCTGCCTCCTTCTCTCGAGAGAAGGAGGCAGGTATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-187s21c1
Sequence:CCGGCAGATCTGGAAACCTCTAGAACTCGAGTTCTAGAGGTTTCCAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-210s21c1
Sequence:CCGGAGTAATCACGGCAACAGCAAGCTCGAGCTTGCTGTTGCCGTGATTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025384.3-291s21c1
Sequence:CCGGTAAGCGAGAGGCTAGTCTTATCTCGAGATAAGACTAGCCTCTCGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013238
VALIDATED
DNAJC15 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 15
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013238.1-588s1c1
Sequence:CCGGCTACGCATTTCGGATCTGGAACTCGAGTTCCAGATCCGAAATGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013238.1-522s1c1
Sequence:CCGGGCAGGGACTGGTAAGAAGTTTCTCGAGAAACTTCTTACCAGTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013238.1-562s1c1
Sequence:CCGGGTTGCAGCTCTTGCATTTGCACTCGAGTGCAAATGCAAGAGCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013238.1-751s1c1
Sequence:CCGGGCTAAGATTAGAACAGCTCATCTCGAGATGAGCTGTTCTAATCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013238.1-766s1c1
Sequence:CCGGGCTCATAGGAGAGTCATGATTCTCGAGAATCATGACTCTCCTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013238.1-797s1c1
Sequence:CCGGCAGATAAAGGTGGATCTCCTTCTCGAGAAGGAGATCCACCTTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013238.2-540s21c1
Sequence:CCGGGTTGCAGCTCTTGCATTTGCACTCGAGTGCAAATGCAAGAGCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013238.2-1265s21c1
Sequence:CCGGTTTGGGACTCTGCCTATATAACTCGAGTTATATAGGCAGAGTCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013238.2-744s21c1
Sequence:CCGGGCTCATAGGAGAGTCATGATTCTCGAGAATCATGACTCTCCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013238.2-729s21c1
Sequence:CCGGGCTAAGATTAGAACAGCTCATCTCGAGATGAGCTGTTCTAATCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013238.2-682s21c1
Sequence:CCGGGGCGAGAAGCTGGTCTTATTTCTCGAGAAATAAGACCAGCTTCTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013238
VALIDATED
DNAJC15 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 15
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013238.1-588s1c1
Sequence:CCGGCTACGCATTTCGGATCTGGAACTCGAGTTCCAGATCCGAAATGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013238.1-522s1c1
Sequence:CCGGGCAGGGACTGGTAAGAAGTTTCTCGAGAAACTTCTTACCAGTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013238.1-562s1c1
Sequence:CCGGGTTGCAGCTCTTGCATTTGCACTCGAGTGCAAATGCAAGAGCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013238.1-751s1c1
Sequence:CCGGGCTAAGATTAGAACAGCTCATCTCGAGATGAGCTGTTCTAATCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013238.1-766s1c1
Sequence:CCGGGCTCATAGGAGAGTCATGATTCTCGAGAATCATGACTCTCCTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013238.1-797s1c1
Sequence:CCGGCAGATAAAGGTGGATCTCCTTCTCGAGAAGGAGATCCACCTTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013238.2-540s21c1
Sequence:CCGGGTTGCAGCTCTTGCATTTGCACTCGAGTGCAAATGCAAGAGCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013238.2-1265s21c1
Sequence:CCGGTTTGGGACTCTGCCTATATAACTCGAGTTATATAGGCAGAGTCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013238.2-744s21c1
Sequence:CCGGGCTCATAGGAGAGTCATGATTCTCGAGAATCATGACTCTCCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013238.2-729s21c1
Sequence:CCGGGCTAAGATTAGAACAGCTCATCTCGAGATGAGCTGTTCTAATCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013238.2-682s21c1
Sequence:CCGGGGCGAGAAGCTGGTCTTATTTCTCGAGAAATAAGACCAGCTTCTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013238
VALIDATED
DNAJC15 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 15
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013238.1-588s1c1
Sequence:CCGGCTACGCATTTCGGATCTGGAACTCGAGTTCCAGATCCGAAATGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013238.1-522s1c1
Sequence:CCGGGCAGGGACTGGTAAGAAGTTTCTCGAGAAACTTCTTACCAGTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013238.1-562s1c1
Sequence:CCGGGTTGCAGCTCTTGCATTTGCACTCGAGTGCAAATGCAAGAGCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013238.1-751s1c1
Sequence:CCGGGCTAAGATTAGAACAGCTCATCTCGAGATGAGCTGTTCTAATCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013238.1-766s1c1
Sequence:CCGGGCTCATAGGAGAGTCATGATTCTCGAGAATCATGACTCTCCTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013238.1-797s1c1
Sequence:CCGGCAGATAAAGGTGGATCTCCTTCTCGAGAAGGAGATCCACCTTTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013238.2-540s21c1
Sequence:CCGGGTTGCAGCTCTTGCATTTGCACTCGAGTGCAAATGCAAGAGCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013238.2-1265s21c1
Sequence:CCGGTTTGGGACTCTGCCTATATAACTCGAGTTATATAGGCAGAGTCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013238.2-744s21c1
Sequence:CCGGGCTCATAGGAGAGTCATGATTCTCGAGAATCATGACTCTCCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013238.2-729s21c1
Sequence:CCGGGCTAAGATTAGAACAGCTCATCTCGAGATGAGCTGTTCTAATCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013238.2-682s21c1
Sequence:CCGGGGCGAGAAGCTGGTCTTATTTCTCGAGAAATAAGACCAGCTTCTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks