EMAIL THIS PAGE TO A FRIEND

DNAJC17

DnaJ (Hsp40) homolog, subfamily C, member 17

62 Gene Product Result for
UniProtKB ID: Q9NVM6
Gene ID:
Mouse(69408) DnaJ (Hsp40) homolog, subfamily C, member 17
Rat(311329) DnaJ (Hsp40) homolog, subfamily C, member 17
Zebrafish(393216) DnaJ (Hsp40) homolog, subfamily C, member 17
cow(524795) DnaJ (Hsp40) homolog, subfamily C, member 17
domestic cat(101087999) DnaJ (Hsp40) homolog, subfamily C, member 17
dog(478261) DnaJ (Hsp40) homolog, subfamily C, member 17
chicken(770519) DnaJ (Hsp40) homolog, subfamily C, member 17
Goat(100860974) DnaJ (Hsp40) homolog, subfamily C, member 17
sheep(101109709) DnaJ (Hsp40) homolog, subfamily C, member 17
domestic guinea pig(100730943) DnaJ (Hsp40) homolog, subfamily C, member 17
naked mole-rat(101716795) DnaJ (Hsp40) homolog, subfamily C, member 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139139 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139139 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139139 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018163 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018163 Rosetta Predictions human pricing
XM_001080801 Rosetta Predictions rat pricing
XM_230468 Rosetta Predictions rat pricing
NM_139139 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098457 predicted 385
2 SASI_Hs01_00098458 predicted 607
3 SASI_Hs01_00098461 predicted 540
4 SASI_Hs01_00098462 predicted 466
5 SASI_Hs02_00351408 predicted 474
6 SASI_Hs01_00098463 predicted 563
7 SASI_Hs01_00098464 predicted 598
8 SASI_Hs01_00098465 predicted 620
9 SASI_Hs02_00351409 predicted 433
10 SASI_Hs02_00351410 predicted 214
11 SASI_Hs01_00098456 predicted 443
12 SASI_Hs01_00098459 predicted 726
13 SASI_Hs01_00098460 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080801 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369422 predicted 382
2 SASI_Rn02_00369423 predicted 377
3 SASI_Rn02_00369424 predicted 575
4 SASI_Rn02_00369425 predicted 277
5 SASI_Rn02_00369426 predicted 372
6 SASI_Rn02_00369427 predicted 611
7 SASI_Rn02_00369428 predicted 651
8 SASI_Rn02_00369429 predicted 721
9 SASI_Rn02_00369430 predicted 647
10 SASI_Rn02_00369431 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386250 predicted 280
2 SASI_Rn02_00386251 predicted 281
3 SASI_Rn02_00386252 predicted 210
4 SASI_Rn01_00143177 predicted 217
5 SASI_Rn01_00143175 predicted 380
6 SASI_Rn02_00386253 predicted 814
7 SASI_Rn01_00143178 predicted 17
8 SASI_Rn02_00386254 predicted 369
9 SASI_Rn02_00386255 predicted 618
10 SASI_Rn01_00143179 predicted 17
11 SASI_Rn01_00143176 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142936 predicted 572
2 SASI_Mm01_00142937 predicted 649
3 SASI_Mm01_00142938 predicted 540
4 SASI_Mm01_00142939 predicted 365
5 SASI_Mm01_00142940 predicted 282
6 SASI_Mm01_00142941 predicted 648
7 SASI_Mm01_00142942 predicted 721
8 SASI_Mm01_00142943 predicted 387
9 SASI_Mm01_00142944 predicted 614
10 SASI_Mm01_00142945 predicted 215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139139
VALIDATED
DNAJC17 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139139.1-286s1c1
Sequence:CCGGAGGAAGAAAGTGAAACTTGATCTCGAGATCAAGTTTCACTTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139139.1-616s1c1
Sequence:CCGGGAGGTTCTCAACCTGGTACTTCTCGAGAAGTACCAGGTTGAGAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139139.1-617s1c1
Sequence:CCGGAGGTTCTCAACCTGGTACTTTCTCGAGAAAGTACCAGGTTGAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139139.1-373s1c1
Sequence:CCGGACCACACTAGAGCAGGAGATTCTCGAGAATCTCCTGCTCTAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139139.1-220s1c1
Sequence:CCGGGCATATGACAAGGTTAGGAAACTCGAGTTTCCTAACCTTGTCATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139139
VALIDATED
DNAJC17 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139139.1-286s1c1
Sequence:CCGGAGGAAGAAAGTGAAACTTGATCTCGAGATCAAGTTTCACTTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139139.1-616s1c1
Sequence:CCGGGAGGTTCTCAACCTGGTACTTCTCGAGAAGTACCAGGTTGAGAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139139.1-617s1c1
Sequence:CCGGAGGTTCTCAACCTGGTACTTTCTCGAGAAAGTACCAGGTTGAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139139.1-373s1c1
Sequence:CCGGACCACACTAGAGCAGGAGATTCTCGAGAATCTCCTGCTCTAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139139.1-220s1c1
Sequence:CCGGGCATATGACAAGGTTAGGAAACTCGAGTTTCCTAACCTTGTCATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139139
VALIDATED
DNAJC17 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139139.1-286s1c1
Sequence:CCGGAGGAAGAAAGTGAAACTTGATCTCGAGATCAAGTTTCACTTTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139139.1-616s1c1
Sequence:CCGGGAGGTTCTCAACCTGGTACTTCTCGAGAAGTACCAGGTTGAGAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139139.1-617s1c1
Sequence:CCGGAGGTTCTCAACCTGGTACTTTCTCGAGAAAGTACCAGGTTGAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139139.1-373s1c1
Sequence:CCGGACCACACTAGAGCAGGAGATTCTCGAGAATCTCCTGCTCTAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139139.1-220s1c1
Sequence:CCGGGCATATGACAAGGTTAGGAAACTCGAGTTTCCTAACCTTGTCATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018163
DNAJC17 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 17
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018163.1-629s1c1
Sequence:CCGGCCTGGTGCTTTCCAGTAAGAACTCGAGTTCTTACTGGAAAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018163.1-781s1c1
Sequence:CCGGGCAGCCACTCAGGACTGTCAACTCGAGTTGACAGTCCTGAGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018163.1-374s1c1
Sequence:CCGGCAGGACACTAGAGCAAGAGATCTCGAGATCTCTTGCTCTAGTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018163.1-719s1c1
Sequence:CCGGCCTGGTGGATAACCCTCTGAACTCGAGTTCAGAGGGTTATCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018163.1-222s1c1
Sequence:CCGGGCATATGACAAGGTCAGGAAACTCGAGTTTCCTGACCTTGTCATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018163.1-75s21c1
Sequence:CCGGGCAGCGGACAAAGAGGTAAAGCTCGAGCTTTACCTCTTTGTCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018163.1-665s21c1
Sequence:CCGGGGTGGAGTTTGCAACCGTCAACTCGAGTTGACGGTTGCAAACTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018163.1-783s21c1
Sequence:CCGGAGCCACTCAGGACTGTCAAAGCTCGAGCTTTGACAGTCCTGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018163.1-629s21c1
Sequence:CCGGCCTGGTGCTTTCCAGTAAGAACTCGAGTTCTTACTGGAAAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018163.1-606s21c1
Sequence:CCGGCAGAAGTATGGTGAGGTTCTCCTCGAGGAGAACCTCACCATACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018163
DNAJC17 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 17
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018163.1-629s1c1
Sequence:CCGGCCTGGTGCTTTCCAGTAAGAACTCGAGTTCTTACTGGAAAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018163.1-781s1c1
Sequence:CCGGGCAGCCACTCAGGACTGTCAACTCGAGTTGACAGTCCTGAGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018163.1-374s1c1
Sequence:CCGGCAGGACACTAGAGCAAGAGATCTCGAGATCTCTTGCTCTAGTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018163.1-719s1c1
Sequence:CCGGCCTGGTGGATAACCCTCTGAACTCGAGTTCAGAGGGTTATCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018163.1-222s1c1
Sequence:CCGGGCATATGACAAGGTCAGGAAACTCGAGTTTCCTGACCTTGTCATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018163.1-75s21c1
Sequence:CCGGGCAGCGGACAAAGAGGTAAAGCTCGAGCTTTACCTCTTTGTCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018163.1-665s21c1
Sequence:CCGGGGTGGAGTTTGCAACCGTCAACTCGAGTTGACGGTTGCAAACTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018163.1-783s21c1
Sequence:CCGGAGCCACTCAGGACTGTCAAAGCTCGAGCTTTGACAGTCCTGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018163.1-629s21c1
Sequence:CCGGCCTGGTGCTTTCCAGTAAGAACTCGAGTTCTTACTGGAAAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018163.1-606s21c1
Sequence:CCGGCAGAAGTATGGTGAGGTTCTCCTCGAGGAGAACCTCACCATACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018163
DNAJC17 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 17
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018163.1-629s1c1
Sequence:CCGGCCTGGTGCTTTCCAGTAAGAACTCGAGTTCTTACTGGAAAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018163.1-781s1c1
Sequence:CCGGGCAGCCACTCAGGACTGTCAACTCGAGTTGACAGTCCTGAGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018163.1-374s1c1
Sequence:CCGGCAGGACACTAGAGCAAGAGATCTCGAGATCTCTTGCTCTAGTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018163.1-719s1c1
Sequence:CCGGCCTGGTGGATAACCCTCTGAACTCGAGTTCAGAGGGTTATCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018163.1-222s1c1
Sequence:CCGGGCATATGACAAGGTCAGGAAACTCGAGTTTCCTGACCTTGTCATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018163.1-75s21c1
Sequence:CCGGGCAGCGGACAAAGAGGTAAAGCTCGAGCTTTACCTCTTTGTCCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018163.1-665s21c1
Sequence:CCGGGGTGGAGTTTGCAACCGTCAACTCGAGTTGACGGTTGCAAACTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018163.1-783s21c1
Sequence:CCGGAGCCACTCAGGACTGTCAAAGCTCGAGCTTTGACAGTCCTGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018163.1-629s21c1
Sequence:CCGGCCTGGTGCTTTCCAGTAAGAACTCGAGTTCTTACTGGAAAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018163.1-606s21c1
Sequence:CCGGCAGAAGTATGGTGAGGTTCTCCTCGAGGAGAACCTCACCATACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks