EMAIL THIS PAGE TO A FRIEND

DNAJC18

DnaJ (Hsp40) homolog, subfamily C, member 18

129 Gene Product Result for
UniProtKB ID: Q9H819
Gene ID:
Mouse(76594) DnaJ (Hsp40) homolog, subfamily C, member 18
Rat(291677) DnaJ (Hsp40) homolog, subfamily C, member 18
naked mole-rat(101721561) DnaJ (Hsp40) homolog, subfamily C, member 18
domestic guinea pig(100733829) DnaJ (Hsp40) homolog, subfamily C, member 18
sheep(101115207) DnaJ (Hsp40) homolog, subfamily C, member 18
Zebrafish(559928) DnaJ (Hsp40) homolog, subfamily C, member 18
chicken(416189) DnaJ (Hsp40) homolog, subfamily C, member 18
cow(533660) DnaJ (Hsp40) homolog, subfamily C, member 18
Horse(100062083) DnaJ (Hsp40) homolog, subfamily C, member 18
domestic cat(101091841) DnaJ (Hsp40) homolog, subfamily C, member 18
dog(606792) DnaJ (Hsp40) homolog, subfamily C, member 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152686 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029669 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029669 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029669 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152686 Rosetta Predictions human pricing
NM_001013887 Rosetta Predictions rat pricing
NM_029669 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209236 predicted 289
2 SASI_Hs01_00209237 predicted 364
3 SASI_Hs01_00209238 predicted 964
4 SASI_Hs02_00366580 predicted 416
5 SASI_Hs01_00209240 predicted 1000
6 SASI_Hs01_00209241 predicted 402
7 SASI_Hs01_00209242 predicted 985
8 SASI_Hs01_00209243 predicted 660
9 SASI_Hs01_00209244 predicted 650
10 SASI_Hs01_00209245 predicted 960
11 SASI_Hs01_00209239 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117068 predicted 466
2 SASI_Rn01_00117069 predicted 475
3 SASI_Rn01_00117070 predicted 718
4 SASI_Rn02_00201166 predicted 738
5 SASI_Rn01_00117071 predicted 677
6 SASI_Rn01_00117073 predicted 728
7 SASI_Rn01_00117074 predicted 710
8 SASI_Rn01_00117075 predicted 385
9 SASI_Rn01_00117076 predicted 1031
10 SASI_Rn01_00117077 predicted 656
11 SASI_Rn01_00117072 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158970 predicted 1191
2 SASI_Mm01_00158971 predicted 1229
3 SASI_Mm01_00158972 predicted 222
4 SASI_Mm01_00158973 predicted 564
5 SASI_Mm01_00158974 predicted 1173
6 SASI_Mm01_00158975 predicted 969
7 SASI_Mm01_00158976 predicted 368
8 SASI_Mm01_00158977 predicted 1076
9 SASI_Mm01_00158978 predicted 1233
10 SASI_Mm01_00158979 predicted 1189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152686
VALIDATED
DNAJC18 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 18
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152686.2-784s21c1
Sequence:CCGGCGACCTTGGGCTACACCATTTCTCGAGAAATGGTGTAGCCCAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152686.2-470s21c1
Sequence:CCGGTCGAGCCAGACCTTATAATTACTCGAGTAATTATAAGGTCTGGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152686.2-1451s21c1
Sequence:CCGGGGCTTAGCCAAAGCTTAATATCTCGAGATATTAAGCTTTGGCTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152686.2-1115s21c1
Sequence:CCGGTGCTACTTGTTCCTATTTATGCTCGAGCATAAATAGGAACAAGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152686.2-1287s21c1
Sequence:CCGGGGAGTAGTTCATCTAAGTTAACTCGAGTTAACTTAGATGAACTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152686.1-714s1c1
Sequence:CCGGCCAGTTCTTGTGATTGTGATTCTCGAGAATCACAATCACAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_152686.1-534s1c1
Sequence:CCGGGAGCTGTTCAACGTCTTCTTTCTCGAGAAAGAAGACGTTGAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152686.1-54s1c1
Sequence:CCGGGCTTACATTGACGCAGTTAGACTCGAGTCTAACTGCGTCAATGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152686.1-974s1c1
Sequence:CCGGGCTGACAAATTTGGCAGGATTCTCGAGAATCCTGCCAAATTTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152686.1-332s1c1
Sequence:CCGGCCTGAAATTTCACCCTGACAACTCGAGTTGTCAGGGTGAAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152686
VALIDATED
DNAJC18 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 18
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152686.2-784s21c1
Sequence:CCGGCGACCTTGGGCTACACCATTTCTCGAGAAATGGTGTAGCCCAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152686.2-470s21c1
Sequence:CCGGTCGAGCCAGACCTTATAATTACTCGAGTAATTATAAGGTCTGGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152686.2-1451s21c1
Sequence:CCGGGGCTTAGCCAAAGCTTAATATCTCGAGATATTAAGCTTTGGCTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152686.2-1115s21c1
Sequence:CCGGTGCTACTTGTTCCTATTTATGCTCGAGCATAAATAGGAACAAGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152686.2-1287s21c1
Sequence:CCGGGGAGTAGTTCATCTAAGTTAACTCGAGTTAACTTAGATGAACTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152686.1-714s1c1
Sequence:CCGGCCAGTTCTTGTGATTGTGATTCTCGAGAATCACAATCACAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_152686.1-534s1c1
Sequence:CCGGGAGCTGTTCAACGTCTTCTTTCTCGAGAAAGAAGACGTTGAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152686.1-54s1c1
Sequence:CCGGGCTTACATTGACGCAGTTAGACTCGAGTCTAACTGCGTCAATGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152686.1-974s1c1
Sequence:CCGGGCTGACAAATTTGGCAGGATTCTCGAGAATCCTGCCAAATTTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152686.1-332s1c1
Sequence:CCGGCCTGAAATTTCACCCTGACAACTCGAGTTGTCAGGGTGAAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152686
VALIDATED
DNAJC18 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 18
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152686.2-784s21c1
Sequence:CCGGCGACCTTGGGCTACACCATTTCTCGAGAAATGGTGTAGCCCAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152686.2-470s21c1
Sequence:CCGGTCGAGCCAGACCTTATAATTACTCGAGTAATTATAAGGTCTGGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152686.2-1451s21c1
Sequence:CCGGGGCTTAGCCAAAGCTTAATATCTCGAGATATTAAGCTTTGGCTAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152686.2-1115s21c1
Sequence:CCGGTGCTACTTGTTCCTATTTATGCTCGAGCATAAATAGGAACAAGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152686.2-1287s21c1
Sequence:CCGGGGAGTAGTTCATCTAAGTTAACTCGAGTTAACTTAGATGAACTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152686.1-714s1c1
Sequence:CCGGCCAGTTCTTGTGATTGTGATTCTCGAGAATCACAATCACAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_152686.1-534s1c1
Sequence:CCGGGAGCTGTTCAACGTCTTCTTTCTCGAGAAAGAAGACGTTGAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152686.1-54s1c1
Sequence:CCGGGCTTACATTGACGCAGTTAGACTCGAGTCTAACTGCGTCAATGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152686.1-974s1c1
Sequence:CCGGGCTGACAAATTTGGCAGGATTCTCGAGAATCCTGCCAAATTTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152686.1-332s1c1
Sequence:CCGGCCTGAAATTTCACCCTGACAACTCGAGTTGTCAGGGTGAAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029669
VALIDATED
DNAJC18 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 18
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029669.4-832s21c1
Sequence:CCGGCCCATATAGTCTGTTCTATAACTCGAGTTATAGAACAGACTATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029669.4-958s21c1
Sequence:CCGGCCTGGAGAAGACAATAGAGAACTCGAGTTCTCTATTGTCTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029669.4-500s21c1
Sequence:CCGGCGCTATGATGAATATGGAGATCTCGAGATCTCCATATTCATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029669.4-1609s21c1
Sequence:CCGGACAGTTCAGTGTTATCCAAATCTCGAGATTTGGATAACACTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029669.4-544s21c1
Sequence:CCGGTCGAGCCAGATCTTATCATTACTCGAGTAATGATAAGATCTGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029669.2-1752s1c1
Sequence:CCGGGCCTCTTGAGAGCTGTGATTTCTCGAGAAATCACAGCTCTCAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029669.2-936s1c1
Sequence:CCGGCCTGGAGAAGACAATAGAGAACTCGAGTTCTCTATTGTCTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029669.2-478s1c1
Sequence:CCGGCGCTATGATGAATATGGAGATCTCGAGATCTCCATATTCATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029669.2-93s1c1
Sequence:CCGGCCAAGCTTACATTGATGCAATCTCGAGATTGCATCAATGTAAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029669.2-810s1c1
Sequence:CCGGCCCATATAGTCTGTTCTATAACTCGAGTTATAGAACAGACTATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029669
VALIDATED
DNAJC18 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 18
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029669.4-832s21c1
Sequence:CCGGCCCATATAGTCTGTTCTATAACTCGAGTTATAGAACAGACTATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029669.4-958s21c1
Sequence:CCGGCCTGGAGAAGACAATAGAGAACTCGAGTTCTCTATTGTCTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029669.4-500s21c1
Sequence:CCGGCGCTATGATGAATATGGAGATCTCGAGATCTCCATATTCATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029669.4-1609s21c1
Sequence:CCGGACAGTTCAGTGTTATCCAAATCTCGAGATTTGGATAACACTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029669.4-544s21c1
Sequence:CCGGTCGAGCCAGATCTTATCATTACTCGAGTAATGATAAGATCTGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029669.2-1752s1c1
Sequence:CCGGGCCTCTTGAGAGCTGTGATTTCTCGAGAAATCACAGCTCTCAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029669.2-936s1c1
Sequence:CCGGCCTGGAGAAGACAATAGAGAACTCGAGTTCTCTATTGTCTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029669.2-478s1c1
Sequence:CCGGCGCTATGATGAATATGGAGATCTCGAGATCTCCATATTCATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029669.2-93s1c1
Sequence:CCGGCCAAGCTTACATTGATGCAATCTCGAGATTGCATCAATGTAAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029669.2-810s1c1
Sequence:CCGGCCCATATAGTCTGTTCTATAACTCGAGTTATAGAACAGACTATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029669
VALIDATED
DNAJC18 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 18
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029669.4-832s21c1
Sequence:CCGGCCCATATAGTCTGTTCTATAACTCGAGTTATAGAACAGACTATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029669.4-958s21c1
Sequence:CCGGCCTGGAGAAGACAATAGAGAACTCGAGTTCTCTATTGTCTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029669.4-500s21c1
Sequence:CCGGCGCTATGATGAATATGGAGATCTCGAGATCTCCATATTCATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029669.4-1609s21c1
Sequence:CCGGACAGTTCAGTGTTATCCAAATCTCGAGATTTGGATAACACTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029669.4-544s21c1
Sequence:CCGGTCGAGCCAGATCTTATCATTACTCGAGTAATGATAAGATCTGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029669.2-1752s1c1
Sequence:CCGGGCCTCTTGAGAGCTGTGATTTCTCGAGAAATCACAGCTCTCAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029669.2-936s1c1
Sequence:CCGGCCTGGAGAAGACAATAGAGAACTCGAGTTCTCTATTGTCTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029669.2-478s1c1
Sequence:CCGGCGCTATGATGAATATGGAGATCTCGAGATCTCCATATTCATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029669.2-93s1c1
Sequence:CCGGCCAAGCTTACATTGATGCAATCTCGAGATTGCATCAATGTAAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029669.2-810s1c1
Sequence:CCGGCCCATATAGTCTGTTCTATAACTCGAGTTATAGAACAGACTATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks