EMAIL THIS PAGE TO A FRIEND

DNAJC19

DnaJ (Hsp40) homolog, subfamily C, member 19

Synonyms: PAM18 TIM14 TIMM14
UniProtKB ID: Q96DA6, B2R4B1, C9JBV1
Gene ID:
Human(131118) Summary: The protein encoded by this gene is thought to be part of a complex involved in the ATP-dependent transport of transit peptide-containing proteins from the inner cell membrane to the mitochondrial matrix. Defects in this gene are a cause of 3-methylglutaconic aciduria type 5 (MGA5), also known as dilated cardiomyopathy with ataxia (DCMA). Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1, 2, 6, 10, 14 and 19. [provided by RefSeq, Jan 2012]
Mouse(67713) DnaJ (Hsp40) homolog, subfamily C, member 19
Zebrafish(393734) DnaJ (Hsp40) homolog, subfamily C, member 19
cow(513918) DnaJ (Hsp40) homolog, subfamily C, member 19
domestic cat(101094003) DnaJ (Hsp40) homolog, subfamily C, member 19
chicken(424966) DnaJ (Hsp40) homolog, subfamily C, member 19
dog(488090) DnaJ (Hsp40) homolog, subfamily C, member 19
sheep(101104447) DnaJ (Hsp40) homolog, subfamily C, member 19
domestic guinea pig(100714468) DnaJ (Hsp40) homolog, subfamily C, member 19
naked mole-rat(101722454) DnaJ (Hsp40) homolog, subfamily C, member 19
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201260 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026332 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026332 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026332 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU172631 MISSION® esiRNA esiRNA targeting mouse Dnajc19 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145261 Rosetta Predictions human pricing
NM_201259 Rosetta Predictions human pricing
NM_201260 Rosetta Predictions human pricing
NM_201261 Rosetta Predictions human pricing
NM_001026211 Rosetta Predictions mouse pricing
NM_026332 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055864 predicted 323
2 SASI_Hs01_00055866 predicted 267
3 SASI_Hs01_00055867 predicted 278
4 SASI_Hs02_00365124 predicted 380
5 SASI_Hs02_00365125 predicted 480
6 SASI_Hs02_00365126 predicted 329
7 SASI_Hs02_00365127 predicted 347
8 SASI_Hs02_00365128 predicted 410
9 SASI_Hs02_00365129 predicted 370
10 SASI_Hs02_00365130 predicted 455
11 SASI_Hs01_00055862 predicted 563
12 SASI_Hs01_00055863 predicted 558
13 SASI_Hs01_00055865 predicted 217
14 SASI_Hs01_00055868 predicted 666
15 SASI_Hs01_00055869 predicted 418
16 SASI_Hs01_00055870 predicted 744
17 SASI_Hs01_00055871 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194853 predicted 507
2 SASI_Hs01_00194854 predicted 506
3 SASI_Hs01_00194855 predicted 273
4 SASI_Hs01_00194856 predicted 225
5 SASI_Hs01_00194857 predicted 233
6 SASI_Hs01_00194858 predicted 334
7 SASI_Hs01_00194859 predicted 434
8 SASI_Hs01_00194860 predicted 607
9 SASI_Hs01_00194861 predicted 280
10 SASI_Hs01_00194862 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143060 predicted 479
2 SASI_Hs01_00143061 predicted 479
3 SASI_Hs01_00143062 predicted 219
4 SASI_Hs01_00143063 predicted 144
5 SASI_Hs01_00143064 predicted 226
6 SASI_Hs01_00143065 predicted 616
7 SASI_Hs01_00143066 predicted 276
8 SASI_Hs01_00143067 predicted 585
9 SASI_Hs01_00143068 predicted 333
10 SASI_Hs01_00143069 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113865 predicted 510
2 SASI_Hs01_00113866 predicted 505
3 SASI_Hs01_00113867 predicted 217
4 SASI_Hs01_00113868 predicted 273
5 SASI_Hs01_00113869 predicted 300
6 SASI_Hs01_00113870 predicted 146
7 SASI_Hs01_00113871 predicted 331
8 SASI_Hs01_00113872 predicted 637
9 SASI_Hs01_00113873 predicted 605
10 SASI_Hs01_00113874 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001026211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047510 predicted 260
2 SASI_Mm01_00047512 predicted 213
3 SASI_Mm01_00047513 predicted 216
4 SASI_Mm01_00047514 predicted 272
5 SASI_Mm01_00047515 predicted 284
6 SASI_Mm01_00047516 predicted 215
7 SASI_Mm01_00047517 predicted 206
8 SASI_Mm01_00047518 predicted 215
9 SASI_Mm01_00047519 predicted 265
10 SASI_Mm02_00288010 predicted 263
11 SASI_Mm01_00047511 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026332 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122152 predicted 383
2 SASI_Mm01_00122153 predicted 319
3 SASI_Mm01_00122154 predicted 322
4 SASI_Mm02_00330047 predicted 370
5 SASI_Mm01_00122155 predicted 375
6 SASI_Mm01_00122156 predicted 211
7 SASI_Mm01_00122157 predicted 411
8 SASI_Mm01_00122158 predicted 379
9 SASI_Mm01_00122159 predicted 281
10 SASI_Mm01_00122161 predicted 408
11 SASI_Mm01_00122160 predicted 388
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201260
DNAJC19 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 19
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201260.1-209s1c1
Sequence:CCGGGCAAGCCATGAAGCATATGGACTCGAGTCCATATGCTTCATGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201260.1-730s1c1
Sequence:CCGGCCACTTTAATGGGAGACTGATCTCGAGATCAGTCTCCCATTAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201260.1-616s1c1
Sequence:CCGGGCACACACCTTCTGAATAGAACTCGAGTTCTATTCAGAAGGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201260.1-799s1c1
Sequence:CCGGGCTGTTTAAGTAGGGACTCTTCTCGAGAAGAGTCCCTACTTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201260.1-907s1c1
Sequence:CCGGCCACAACTGAGACCTAAGAAACTCGAGTTTCTTAGGTCTCAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201260.1-1037s1c1
Sequence:CCGGCACAGTTCATTGCAGCCTCAACTCGAGTTGAGGCTGCAATGAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201260.1-187s1c1
Sequence:CCGGGATTTGCAGGCCGTTACGTTTCTCGAGAAACGTAACGGCCTGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201260
DNAJC19 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 19
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201260.1-209s1c1
Sequence:CCGGGCAAGCCATGAAGCATATGGACTCGAGTCCATATGCTTCATGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201260.1-730s1c1
Sequence:CCGGCCACTTTAATGGGAGACTGATCTCGAGATCAGTCTCCCATTAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201260.1-616s1c1
Sequence:CCGGGCACACACCTTCTGAATAGAACTCGAGTTCTATTCAGAAGGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201260.1-799s1c1
Sequence:CCGGGCTGTTTAAGTAGGGACTCTTCTCGAGAAGAGTCCCTACTTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201260.1-907s1c1
Sequence:CCGGCCACAACTGAGACCTAAGAAACTCGAGTTTCTTAGGTCTCAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201260.1-1037s1c1
Sequence:CCGGCACAGTTCATTGCAGCCTCAACTCGAGTTGAGGCTGCAATGAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201260.1-187s1c1
Sequence:CCGGGATTTGCAGGCCGTTACGTTTCTCGAGAAACGTAACGGCCTGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201260
DNAJC19 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 19
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201260.1-209s1c1
Sequence:CCGGGCAAGCCATGAAGCATATGGACTCGAGTCCATATGCTTCATGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201260.1-730s1c1
Sequence:CCGGCCACTTTAATGGGAGACTGATCTCGAGATCAGTCTCCCATTAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201260.1-616s1c1
Sequence:CCGGGCACACACCTTCTGAATAGAACTCGAGTTCTATTCAGAAGGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201260.1-799s1c1
Sequence:CCGGGCTGTTTAAGTAGGGACTCTTCTCGAGAAGAGTCCCTACTTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201260.1-907s1c1
Sequence:CCGGCCACAACTGAGACCTAAGAAACTCGAGTTTCTTAGGTCTCAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201260.1-1037s1c1
Sequence:CCGGCACAGTTCATTGCAGCCTCAACTCGAGTTGAGGCTGCAATGAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201260.1-187s1c1
Sequence:CCGGGATTTGCAGGCCGTTACGTTTCTCGAGAAACGTAACGGCCTGCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026332
VALIDATED
DNAJC19 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 19
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026332.2-224s1c1
Sequence:CCGGCAGAGGTGGATTTGAACCCAACTCGAGTTGGGTTCAAATCCACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026332.2-573s1c1
Sequence:CCGGCGGTAAACATTACTACTACTTCTCGAGAAGTAGTAGTAATGTTTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026332.2-261s1c1
Sequence:CCGGGCAGCATTAATATTAGGTGTACTCGAGTACACCTAATATTAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026332.2-396s1c1
Sequence:CCGGGCTAATTCTTGGTGTTATGAACTCGAGTTCATAACACCAAGAATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026332.3-182s21c1
Sequence:CCGGCAGGATTTGCAGGCCGTTATGCTCGAGCATAACGGCCTGCAAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026332.3-463s21c1
Sequence:CCGGTTACTAGAAGGACAAGCTAAACTCGAGTTTAGCTTGTCCTTCTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026332.3-325s21c1
Sequence:CCGGGCAGCATTAATATTAGGTGTACTCGAGTACACCTAATATTAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026332.3-382s21c1
Sequence:CCGGCATCGCCGGATTATGCTATTACTCGAGTAATAGCATAATCCGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026332.3-288s21c1
Sequence:CCGGCAGAGGTGGATTTGAACCCAACTCGAGTTGGGTTCAAATCCACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026332
VALIDATED
DNAJC19 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 19
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026332.2-224s1c1
Sequence:CCGGCAGAGGTGGATTTGAACCCAACTCGAGTTGGGTTCAAATCCACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026332.2-573s1c1
Sequence:CCGGCGGTAAACATTACTACTACTTCTCGAGAAGTAGTAGTAATGTTTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026332.2-261s1c1
Sequence:CCGGGCAGCATTAATATTAGGTGTACTCGAGTACACCTAATATTAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026332.2-396s1c1
Sequence:CCGGGCTAATTCTTGGTGTTATGAACTCGAGTTCATAACACCAAGAATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026332.3-182s21c1
Sequence:CCGGCAGGATTTGCAGGCCGTTATGCTCGAGCATAACGGCCTGCAAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026332.3-463s21c1
Sequence:CCGGTTACTAGAAGGACAAGCTAAACTCGAGTTTAGCTTGTCCTTCTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026332.3-325s21c1
Sequence:CCGGGCAGCATTAATATTAGGTGTACTCGAGTACACCTAATATTAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026332.3-382s21c1
Sequence:CCGGCATCGCCGGATTATGCTATTACTCGAGTAATAGCATAATCCGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026332.3-288s21c1
Sequence:CCGGCAGAGGTGGATTTGAACCCAACTCGAGTTGGGTTCAAATCCACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026332
VALIDATED
DNAJC19 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 19
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026332.2-224s1c1
Sequence:CCGGCAGAGGTGGATTTGAACCCAACTCGAGTTGGGTTCAAATCCACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026332.2-573s1c1
Sequence:CCGGCGGTAAACATTACTACTACTTCTCGAGAAGTAGTAGTAATGTTTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026332.2-261s1c1
Sequence:CCGGGCAGCATTAATATTAGGTGTACTCGAGTACACCTAATATTAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026332.2-396s1c1
Sequence:CCGGGCTAATTCTTGGTGTTATGAACTCGAGTTCATAACACCAAGAATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026332.3-182s21c1
Sequence:CCGGCAGGATTTGCAGGCCGTTATGCTCGAGCATAACGGCCTGCAAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026332.3-463s21c1
Sequence:CCGGTTACTAGAAGGACAAGCTAAACTCGAGTTTAGCTTGTCCTTCTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026332.3-325s21c1
Sequence:CCGGGCAGCATTAATATTAGGTGTACTCGAGTACACCTAATATTAATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026332.3-382s21c1
Sequence:CCGGCATCGCCGGATTATGCTATTACTCGAGTAATAGCATAATCCGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026332.3-288s21c1
Sequence:CCGGCAGAGGTGGATTTGAACCCAACTCGAGTTGGGTTCAAATCCACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks