EMAIL THIS PAGE TO A FRIEND

DNAJC1

DnaJ (Hsp40) homolog, subfamily C, member 1

58 Gene Product Result for
Synonyms: DNAJL1 ERdj1 HTJ1 MTJ1
UniProtKB ID: Q96KC8, B0YIZ8, Q5VX89, Q9H6B8
Gene ID:
Mouse(13418) DnaJ (Hsp40) homolog, subfamily C, member 1
Rat(291369) DnaJ (Hsp40) homolog, subfamily C, member 1
Zebrafish(553324) DnaJ (Hsp40) homolog, subfamily C, member 1
chicken(420508) DnaJ (Hsp40) homolog, subfamily C, member 1
dog(607587) DnaJ (Hsp40) homolog, subfamily C, member 1
domestic cat(101095666) DnaJ (Hsp40) homolog, subfamily C, member 1
cow(781036) DnaJ (Hsp40) homolog, subfamily C, member 1
Horse(100067167) DnaJ (Hsp40) homolog, subfamily C, member 1
sheep(101102829) DnaJ (Hsp40) homolog, subfamily C, member 1
Domestic Rabbit(100341962) DnaJ (Hsp40) homolog, subfamily C, member 1
domestic guinea pig(100722409) DnaJ (Hsp40) homolog, subfamily C, member 1
naked mole-rat(101708839) DnaJ (Hsp40) homolog, subfamily C, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022365 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022365 Rosetta Predictions human pricing
XM_214522 Rosetta Predictions rat pricing
NM_007869 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065765 predicted 1148
2 SASI_Hs01_00065767 predicted 1468
3 SASI_Hs01_00065768 predicted 1277
4 SASI_Hs02_00355662 predicted 1833
5 SASI_Hs01_00065769 predicted 1763
6 SASI_Hs01_00065770 predicted 1506
7 SASI_Hs02_00355663 predicted 1490
8 SASI_Hs01_00065772 predicted 1071
9 SASI_Hs01_00065773 predicted 1163
10 SASI_Hs01_00065774 predicted 1362
11 SASI_Hs01_00065766 predicted 1509
12 SASI_Hs01_00065771 predicted 993
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00170770 predicted 332
2 SASI_Rn01_00170771 predicted 274
3 SASI_Rn01_00170772 predicted 849
4 SASI_Rn01_00170773 predicted 919
5 SASI_Rn01_00170774 predicted 307
6 SASI_Rn01_00170775 predicted 1554
7 SASI_Rn01_00170776 predicted 303
8 SASI_Rn01_00170777 predicted 283
9 SASI_Rn01_00170778 predicted 1143
10 SASI_Rn01_00170779 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129115 predicted 242
2 SASI_Mm01_00129116 predicted 1515
3 SASI_Mm02_00312655 predicted 1155
4 SASI_Mm01_00129117 predicted 1218
5 SASI_Mm02_00312656 predicted 262
6 SASI_Mm01_00129118 predicted 887
7 SASI_Mm01_00129119 predicted 613
8 SASI_Mm01_00129120 predicted 1504
9 SASI_Mm01_00129122 predicted 1521
10 SASI_Mm01_00129123 predicted 844
11 SASI_Mm01_00129121 predicted 250
12 SASI_Mm01_00129124 predicted 1016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007869
VALIDATED
DNAJC1 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007869.1-275s1c1
Sequence:CCGGCCAGACAAGAATAAAGATGAACTCGAGTTCATCTTTATTCTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007869.1-181s1c1
Sequence:CCGGGCAGTTGAACTTCTACGAGTTCTCGAGAACTCGTAGAAGTTCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007869.1-857s1c1
Sequence:CCGGCCTGTGTATATGCCTTTAGAACTCGAGTTCTAAAGGCATATACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007869.1-1610s1c1
Sequence:CCGGGCTAGATACAAGCTGCTGGTTCTCGAGAACCAGCAGCTTGTATCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007869.2-1610s21c1
Sequence:CCGGGCTAGATACAAGCTGCTGGTTCTCGAGAACCAGCAGCTTGTATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007869.2-1012s21c1
Sequence:CCGGACTGACAAGAAGTATGGTTAACTCGAGTTAACCATACTTCTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007869.2-622s21c1
Sequence:CCGGGAACGAAAGATTGCTTATAAACTCGAGTTTATAAGCAATCTTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007869.2-857s21c1
Sequence:CCGGCCTGTGTATATGCCTTTAGAACTCGAGTTCTAAAGGCATATACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007869.2-181s21c1
Sequence:CCGGGCAGTTGAACTTCTACGAGTTCTCGAGAACTCGTAGAAGTTCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007869
VALIDATED
DNAJC1 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007869.1-275s1c1
Sequence:CCGGCCAGACAAGAATAAAGATGAACTCGAGTTCATCTTTATTCTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007869.1-181s1c1
Sequence:CCGGGCAGTTGAACTTCTACGAGTTCTCGAGAACTCGTAGAAGTTCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007869.1-857s1c1
Sequence:CCGGCCTGTGTATATGCCTTTAGAACTCGAGTTCTAAAGGCATATACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007869.1-1610s1c1
Sequence:CCGGGCTAGATACAAGCTGCTGGTTCTCGAGAACCAGCAGCTTGTATCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007869.2-1610s21c1
Sequence:CCGGGCTAGATACAAGCTGCTGGTTCTCGAGAACCAGCAGCTTGTATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007869.2-1012s21c1
Sequence:CCGGACTGACAAGAAGTATGGTTAACTCGAGTTAACCATACTTCTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007869.2-622s21c1
Sequence:CCGGGAACGAAAGATTGCTTATAAACTCGAGTTTATAAGCAATCTTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007869.2-857s21c1
Sequence:CCGGCCTGTGTATATGCCTTTAGAACTCGAGTTCTAAAGGCATATACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007869.2-181s21c1
Sequence:CCGGGCAGTTGAACTTCTACGAGTTCTCGAGAACTCGTAGAAGTTCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007869
VALIDATED
DNAJC1 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007869.1-275s1c1
Sequence:CCGGCCAGACAAGAATAAAGATGAACTCGAGTTCATCTTTATTCTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007869.1-181s1c1
Sequence:CCGGGCAGTTGAACTTCTACGAGTTCTCGAGAACTCGTAGAAGTTCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007869.1-857s1c1
Sequence:CCGGCCTGTGTATATGCCTTTAGAACTCGAGTTCTAAAGGCATATACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007869.1-1610s1c1
Sequence:CCGGGCTAGATACAAGCTGCTGGTTCTCGAGAACCAGCAGCTTGTATCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007869.2-1610s21c1
Sequence:CCGGGCTAGATACAAGCTGCTGGTTCTCGAGAACCAGCAGCTTGTATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007869.2-1012s21c1
Sequence:CCGGACTGACAAGAAGTATGGTTAACTCGAGTTAACCATACTTCTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007869.2-622s21c1
Sequence:CCGGGAACGAAAGATTGCTTATAAACTCGAGTTTATAAGCAATCTTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007869.2-857s21c1
Sequence:CCGGCCTGTGTATATGCCTTTAGAACTCGAGTTCTAAAGGCATATACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007869.2-181s21c1
Sequence:CCGGGCAGTTGAACTTCTACGAGTTCTCGAGAACTCGTAGAAGTTCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022365
VALIDATED
DNAJC1 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022365.2-566s1c1
Sequence:CCGGGCTGGCATTACTCTTGTTCATCTCGAGATGAACAAGAGTAATGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022365.2-357s1c1
Sequence:CCGGGCATATCGTAAGCTTTCACTACTCGAGTAGTGAAAGCTTACGATATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022365.2-293s1c1
Sequence:CCGGGCAGCTCAACTTCTACCAGTTCTCGAGAACTGGTAGAAGTTGAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022365.2-1719s1c1
Sequence:CCGGAGGTACAAGTTGCTGGTTGAACTCGAGTTCAACCAGCAACTTGTACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022365.2-691s1c1
Sequence:CCGGGCAGCAAGAGTGTGGATGTATCTCGAGATACATCCACACTCTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022365.3-871s21c1
Sequence:CCGGGCAGCAAGAGTGTGGATGTATCTCGAGATACATCCACACTCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022365.3-537s21c1
Sequence:CCGGGCATATCGTAAGCTTTCACTACTCGAGTAGTGAAAGCTTACGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022365.3-1963s21c1
Sequence:CCGGAGATGATGTTCACCTTCATTTCTCGAGAAATGAAGGTGAACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022365.3-473s21c1
Sequence:CCGGGCAGCTCAACTTCTACCAGTTCTCGAGAACTGGTAGAAGTTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022365
VALIDATED
DNAJC1 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022365.2-566s1c1
Sequence:CCGGGCTGGCATTACTCTTGTTCATCTCGAGATGAACAAGAGTAATGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022365.2-357s1c1
Sequence:CCGGGCATATCGTAAGCTTTCACTACTCGAGTAGTGAAAGCTTACGATATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022365.2-293s1c1
Sequence:CCGGGCAGCTCAACTTCTACCAGTTCTCGAGAACTGGTAGAAGTTGAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022365.2-1719s1c1
Sequence:CCGGAGGTACAAGTTGCTGGTTGAACTCGAGTTCAACCAGCAACTTGTACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022365.2-691s1c1
Sequence:CCGGGCAGCAAGAGTGTGGATGTATCTCGAGATACATCCACACTCTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022365.3-871s21c1
Sequence:CCGGGCAGCAAGAGTGTGGATGTATCTCGAGATACATCCACACTCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022365.3-537s21c1
Sequence:CCGGGCATATCGTAAGCTTTCACTACTCGAGTAGTGAAAGCTTACGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022365.3-1963s21c1
Sequence:CCGGAGATGATGTTCACCTTCATTTCTCGAGAAATGAAGGTGAACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022365.3-473s21c1
Sequence:CCGGGCAGCTCAACTTCTACCAGTTCTCGAGAACTGGTAGAAGTTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022365
VALIDATED
DNAJC1 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022365.2-566s1c1
Sequence:CCGGGCTGGCATTACTCTTGTTCATCTCGAGATGAACAAGAGTAATGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022365.2-357s1c1
Sequence:CCGGGCATATCGTAAGCTTTCACTACTCGAGTAGTGAAAGCTTACGATATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022365.2-293s1c1
Sequence:CCGGGCAGCTCAACTTCTACCAGTTCTCGAGAACTGGTAGAAGTTGAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022365.2-1719s1c1
Sequence:CCGGAGGTACAAGTTGCTGGTTGAACTCGAGTTCAACCAGCAACTTGTACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022365.2-691s1c1
Sequence:CCGGGCAGCAAGAGTGTGGATGTATCTCGAGATACATCCACACTCTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022365.3-871s21c1
Sequence:CCGGGCAGCAAGAGTGTGGATGTATCTCGAGATACATCCACACTCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022365.3-537s21c1
Sequence:CCGGGCATATCGTAAGCTTTCACTACTCGAGTAGTGAAAGCTTACGATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022365.3-1963s21c1
Sequence:CCGGAGATGATGTTCACCTTCATTTCTCGAGAAATGAAGGTGAACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022365.3-473s21c1
Sequence:CCGGGCAGCTCAACTTCTACCAGTTCTCGAGAACTGGTAGAAGTTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks