EMAIL THIS PAGE TO A FRIEND

DNAJC21

DnaJ (Hsp40) homolog, subfamily C, member 21

118 Gene Product Result for
Synonyms: DNAJA5 GS3 JJJ1
UniProtKB ID: Q5F1R6, Q3B7J9, Q6P086, Q6ZS43, Q86VC6
Gene ID:
Mouse(78244) DnaJ (Hsp40) homolog, subfamily C, member 21
Rat(192210) DnaJ (Hsp40) homolog, subfamily C, member 21
domestic guinea pig(100722631) DnaJ (Hsp40) homolog, subfamily C, member 21
naked mole-rat(101713229) DnaJ (Hsp40) homolog, subfamily C, member 21
sheep(101111907) DnaJ (Hsp40) homolog, subfamily C, member 21
Domestic Rabbit(100341177) DnaJ (Hsp40) homolog, subfamily C, member 21
Zebrafish(336984) DnaJ (Hsp40) homolog, subfamily C, member 21
cow(509302) DnaJ (Hsp40) homolog, subfamily C, member 21
Horse(100068089) DnaJ (Hsp40) homolog, subfamily C, member 21
chicken(427434) DnaJ (Hsp40) homolog, subfamily C, member 21
domestic cat(101098197) DnaJ (Hsp40) homolog, subfamily C, member 21
dog(479364) DnaJ (Hsp40) homolog, subfamily C, member 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194283 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030046 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030046 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030046 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012339 Rosetta Predictions human pricing
NM_194283 Rosetta Predictions human pricing
NM_138856 Rosetta Predictions rat pricing
NM_030046 Rosetta Predictions mouse pricing
XM_001473469 Rosetta Predictions mouse pricing
XM_001473643 Rosetta Predictions mouse pricing
XM_127961 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063526 predicted 980
2 SASI_Hs01_00063527 predicted 1748
3 SASI_Hs01_00063528 predicted 608
4 SASI_Hs01_00063529 predicted 1648
5 SASI_Hs01_00063530 predicted 499
6 SASI_Hs01_00063531 predicted 952
7 SASI_Hs01_00063532 predicted 1834
8 SASI_Hs01_00063533 predicted 1648
9 SASI_Hs01_00063534 predicted 1773
10 SASI_Hs01_00063535 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051658 predicted 981
2 SASI_Hs01_00051659 predicted 1887
3 SASI_Hs01_00051660 predicted 608
4 SASI_Hs01_00051661 predicted 1779
5 SASI_Hs01_00051662 predicted 505
6 SASI_Hs01_00051663 predicted 950
7 SASI_Hs01_00051664 predicted 1973
8 SASI_Hs01_00051665 predicted 1785
9 SASI_Hs01_00051666 predicted 1914
10 SASI_Hs01_00051667 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268252 predicted 443
2 SASI_Rn02_00268253 predicted 267
3 SASI_Rn02_00268254 predicted 583
4 SASI_Rn02_00268255 predicted 647
5 SASI_Rn02_00268256 predicted 414
6 SASI_Rn02_00268257 predicted 254
7 SASI_Rn02_00268258 predicted 508
8 SASI_Rn02_00268259 predicted 445
9 SASI_Rn02_00268260 predicted 301
10 SASI_Rn02_00268261 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336407 predicted 480
2 SASI_Mm02_00336408 predicted 1155
3 SASI_Mm02_00336409 predicted 1381
4 SASI_Mm02_00336410 predicted 985
5 SASI_Mm02_00336411 predicted 1168
6 SASI_Mm02_00336412 predicted 433
7 SASI_Mm02_00336413 predicted 1093
8 SASI_Mm02_00336414 predicted 402
9 SASI_Mm02_00336415 predicted 1078
10 SASI_Mm02_00336416 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00368400 predicted 473
2 SASI_Mm02_00368401 predicted 1150
3 SASI_Mm02_00368402 predicted 1380
4 SASI_Mm02_00368403 predicted 977
5 SASI_Mm02_00368404 predicted 1170
6 SASI_Mm02_00368405 predicted 428
7 SASI_Mm02_00368406 predicted 1092
8 SASI_Mm02_00368407 predicted 399
9 SASI_Mm02_00368408 predicted 1072
10 SASI_Mm02_00368409 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00369597 predicted 478
2 SASI_Mm02_00369598 predicted 1150
3 SASI_Mm02_00369599 predicted 1375
4 SASI_Mm02_00369600 predicted 980
5 SASI_Mm02_00369601 predicted 1167
6 SASI_Mm02_00369602 predicted 425
7 SASI_Mm02_00369603 predicted 1091
8 SASI_Mm02_00369604 predicted 404
9 SASI_Mm02_00369605 predicted 1070
10 SASI_Mm02_00369606 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127961 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275332 predicted 1408
2 SASI_Mm01_00275333 predicted 563
3 SASI_Mm01_00275334 predicted 1239
4 SASI_Mm01_00275335 predicted 1472
5 SASI_Mm01_00275336 predicted 1070
6 SASI_Mm01_00275337 predicted 515
7 SASI_Mm01_00275338 predicted 1184
8 SASI_Mm01_00275339 predicted 496
9 SASI_Mm01_00275340 predicted 1166
10 SASI_Mm01_00275341 predicted 1353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194283
VALIDATED
DNAJC21 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 21
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194283.1-1029s1c1
Sequence:CCGGGATCCAGAAGATACTAACTTACTCGAGTAAGTTAGTATCTTCTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194283.1-1317s1c1
Sequence:CCGGGCACCTTCATCATCGTCTTTACTCGAGTAAAGACGATGATGAAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194283.1-531s1c1
Sequence:CCGGGAACTCAAAGATGAGGAGGATCTCGAGATCCTCCTCATCTTTGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194283.1-1342s1c1
Sequence:CCGGGCGCAACAAGTAGTCAAAGCACTCGAGTGCTTTGACTACTTGTTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_194283.1-381s1c1
Sequence:CCGGCAGAAGCTAAAGCAGGCCAAACTCGAGTTTGGCCTGCTTTAGCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194283.1-640s1c1
Sequence:CCGGCCATGAAGAATCACGAGAAGTCTCGAGACTTCTCGTGATTCTTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194283.1-78s1c1
Sequence:CCGGCAGAGTGACTATGATACGGTACTCGAGTACCGTATCATAGTCACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_194283.1-84s1c1
Sequence:CCGGGACTATGATACGGTAGTCCATCTCGAGATGGACTACCGTATCATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_194283.1-272s1c1
Sequence:CCGGGCTGGTAGCTTTCATTCGTAACTCGAGTTACGAATGAAAGCTACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194283.1-615s1c1
Sequence:CCGGGACAAATCGTTCAAGACAGAACTCGAGTTCTGTCTTGAACGATTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_194283.1-150s1c1
Sequence:CCGGGCATGGAAGGAAGAATATGATCTCGAGATCATATTCTTCCTTCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194283.3-1229s21c1
Sequence:CCGGGTCAAAGAAGCATCGGGAAATCTCGAGATTTCCCGATGCTTCTTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194283.3-2245s21c1
Sequence:CCGGTACAGGGAGAATTACATTATTCTCGAGAATAATGTAATTCTCCCTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194283.3-1830s21c1
Sequence:CCGGGAATTTCCATCTCGGAATAAACTCGAGTTTATTCCGAGATGGAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194283
VALIDATED
DNAJC21 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 21
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194283.1-1029s1c1
Sequence:CCGGGATCCAGAAGATACTAACTTACTCGAGTAAGTTAGTATCTTCTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194283.1-1317s1c1
Sequence:CCGGGCACCTTCATCATCGTCTTTACTCGAGTAAAGACGATGATGAAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194283.1-531s1c1
Sequence:CCGGGAACTCAAAGATGAGGAGGATCTCGAGATCCTCCTCATCTTTGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194283.1-1342s1c1
Sequence:CCGGGCGCAACAAGTAGTCAAAGCACTCGAGTGCTTTGACTACTTGTTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_194283.1-381s1c1
Sequence:CCGGCAGAAGCTAAAGCAGGCCAAACTCGAGTTTGGCCTGCTTTAGCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194283.1-640s1c1
Sequence:CCGGCCATGAAGAATCACGAGAAGTCTCGAGACTTCTCGTGATTCTTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194283.1-78s1c1
Sequence:CCGGCAGAGTGACTATGATACGGTACTCGAGTACCGTATCATAGTCACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_194283.1-84s1c1
Sequence:CCGGGACTATGATACGGTAGTCCATCTCGAGATGGACTACCGTATCATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_194283.1-272s1c1
Sequence:CCGGGCTGGTAGCTTTCATTCGTAACTCGAGTTACGAATGAAAGCTACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194283.1-615s1c1
Sequence:CCGGGACAAATCGTTCAAGACAGAACTCGAGTTCTGTCTTGAACGATTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_194283.1-150s1c1
Sequence:CCGGGCATGGAAGGAAGAATATGATCTCGAGATCATATTCTTCCTTCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194283.3-1229s21c1
Sequence:CCGGGTCAAAGAAGCATCGGGAAATCTCGAGATTTCCCGATGCTTCTTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194283.3-2245s21c1
Sequence:CCGGTACAGGGAGAATTACATTATTCTCGAGAATAATGTAATTCTCCCTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194283.3-1830s21c1
Sequence:CCGGGAATTTCCATCTCGGAATAAACTCGAGTTTATTCCGAGATGGAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194283
VALIDATED
DNAJC21 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 21
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194283.1-1029s1c1
Sequence:CCGGGATCCAGAAGATACTAACTTACTCGAGTAAGTTAGTATCTTCTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194283.1-1317s1c1
Sequence:CCGGGCACCTTCATCATCGTCTTTACTCGAGTAAAGACGATGATGAAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194283.1-531s1c1
Sequence:CCGGGAACTCAAAGATGAGGAGGATCTCGAGATCCTCCTCATCTTTGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194283.1-1342s1c1
Sequence:CCGGGCGCAACAAGTAGTCAAAGCACTCGAGTGCTTTGACTACTTGTTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_194283.1-381s1c1
Sequence:CCGGCAGAAGCTAAAGCAGGCCAAACTCGAGTTTGGCCTGCTTTAGCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194283.1-640s1c1
Sequence:CCGGCCATGAAGAATCACGAGAAGTCTCGAGACTTCTCGTGATTCTTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194283.1-78s1c1
Sequence:CCGGCAGAGTGACTATGATACGGTACTCGAGTACCGTATCATAGTCACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_194283.1-84s1c1
Sequence:CCGGGACTATGATACGGTAGTCCATCTCGAGATGGACTACCGTATCATAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_194283.1-272s1c1
Sequence:CCGGGCTGGTAGCTTTCATTCGTAACTCGAGTTACGAATGAAAGCTACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194283.1-615s1c1
Sequence:CCGGGACAAATCGTTCAAGACAGAACTCGAGTTCTGTCTTGAACGATTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_194283.1-150s1c1
Sequence:CCGGGCATGGAAGGAAGAATATGATCTCGAGATCATATTCTTCCTTCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194283.3-1229s21c1
Sequence:CCGGGTCAAAGAAGCATCGGGAAATCTCGAGATTTCCCGATGCTTCTTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194283.3-2245s21c1
Sequence:CCGGTACAGGGAGAATTACATTATTCTCGAGAATAATGTAATTCTCCCTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194283.3-1830s21c1
Sequence:CCGGGAATTTCCATCTCGGAATAAACTCGAGTTTATTCCGAGATGGAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030046
VALIDATED
DNAJC21 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030046.2-1852s21c1
Sequence:CCGGATTGCATTGTGGAAGATTATTCTCGAGAATAATCTTCCACAATGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030046.2-1626s21c1
Sequence:CCGGGAATTTCCATCCCGGAATAAACTCGAGTTTATTCCGGGATGGAAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030046.2-926s21c1
Sequence:CCGGCTGGATGACCATGGCCAATTTCTCGAGAAATTGGCCATGGTCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030046.2-356s21c1
Sequence:CCGGCCACCGAGAGGCCTTACTTAACTCGAGTTAAGTAAGGCCTCTCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030046.2-772s21c1
Sequence:CCGGTGGTAGCCTTCATTCGTAAACCTCGAGGTTTACGAATGAAGGCTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030046
VALIDATED
DNAJC21 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030046.2-1852s21c1
Sequence:CCGGATTGCATTGTGGAAGATTATTCTCGAGAATAATCTTCCACAATGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030046.2-1626s21c1
Sequence:CCGGGAATTTCCATCCCGGAATAAACTCGAGTTTATTCCGGGATGGAAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030046.2-926s21c1
Sequence:CCGGCTGGATGACCATGGCCAATTTCTCGAGAAATTGGCCATGGTCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030046.2-356s21c1
Sequence:CCGGCCACCGAGAGGCCTTACTTAACTCGAGTTAAGTAAGGCCTCTCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030046.2-772s21c1
Sequence:CCGGTGGTAGCCTTCATTCGTAAACCTCGAGGTTTACGAATGAAGGCTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030046
VALIDATED
DNAJC21 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030046.2-1852s21c1
Sequence:CCGGATTGCATTGTGGAAGATTATTCTCGAGAATAATCTTCCACAATGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030046.2-1626s21c1
Sequence:CCGGGAATTTCCATCCCGGAATAAACTCGAGTTTATTCCGGGATGGAAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030046.2-926s21c1
Sequence:CCGGCTGGATGACCATGGCCAATTTCTCGAGAAATTGGCCATGGTCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030046.2-356s21c1
Sequence:CCGGCCACCGAGAGGCCTTACTTAACTCGAGTTAAGTAAGGCCTCTCGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030046.2-772s21c1
Sequence:CCGGTGGTAGCCTTCATTCGTAAACCTCGAGGTTTACGAATGAAGGCTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)