EMAIL THIS PAGE TO A FRIEND

DNAJC22

DnaJ (Hsp40) homolog, subfamily C, member 22

47 Gene Product Result for
Synonyms: wus
UniProtKB ID: Q8N4W6, B3KP54
Gene ID:
Mouse(72778) DnaJ (Hsp40) homolog, subfamily C, member 22
Rat(362998) DnaJ (Hsp40) homolog, subfamily C, member 22
Zebrafish(796659) DnaJ (Hsp40) homolog, subfamily C, member 22
cow(515215) DnaJ (Hsp40) homolog, subfamily C, member 22
domestic cat(101097158) DnaJ (Hsp40) homolog, subfamily C, member 22
chicken(430880) DnaJ (Hsp40) homolog, subfamily C, member 22
dog(486557) DnaJ (Hsp40) homolog, subfamily C, member 22
sheep(101101970) DnaJ (Hsp40) homolog, subfamily C, member 22
naked mole-rat(101713553) DnaJ (Hsp40) homolog, subfamily C, member 22
domestic guinea pig(100715627) DnaJ (Hsp40) homolog, subfamily C, member 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024902 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176835 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176835 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176835 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024902 Rosetta Predictions human pricing
NM_001014204 Rosetta Predictions rat pricing
NM_176835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128738 predicted 892
2 SASI_Hs01_00128739 predicted 1187
3 SASI_Hs01_00128740 predicted 935
4 SASI_Hs01_00128741 predicted 1180
5 SASI_Hs01_00128742 predicted 1021
6 SASI_Hs01_00128743 predicted 782
7 SASI_Hs01_00128744 predicted 646
8 SASI_Hs01_00128745 predicted 1284
9 SASI_Hs01_00128746 predicted 643
10 SASI_Hs01_00128747 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201728 predicted 765
2 SASI_Rn01_00068447 predicted 674
3 SASI_Rn01_00068448 predicted 663
4 SASI_Rn01_00068449 predicted 796
5 SASI_Rn01_00068450 predicted 404
6 SASI_Rn01_00068451 predicted 807
7 SASI_Rn01_00068452 predicted 947
8 SASI_Rn01_00068453 predicted 790
9 SASI_Rn01_00068455 predicted 616
10 SASI_Rn02_00201729 predicted 647
11 SASI_Rn01_00068446 predicted 627
12 SASI_Rn01_00068454 predicted 1025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163913 predicted 464
2 SASI_Mm01_00163914 predicted 694
3 SASI_Mm01_00163915 predicted 871
4 SASI_Mm01_00163916 predicted 1012
5 SASI_Mm01_00163917 predicted 472
6 SASI_Mm01_00163918 predicted 1199
7 SASI_Mm01_00163919 predicted 864
8 SASI_Mm01_00163920 predicted 243
9 SASI_Mm01_00163921 predicted 718
10 SASI_Mm01_00163922 predicted 710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024902
VALIDATED
DNAJC22 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 22
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024902.2-1180s21c1
Sequence:CCGGGGGCGAAGCTCTATGAGTTTGCTCGAGCAAACTCATAGAGCTTCGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024902.2-1272s21c1
Sequence:CCGGGAAGAAATACATCGGAGTTACCTCGAGGTAACTCCGATGTATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_024902.2-1377s1c1
Sequence:CCGGGCGTATGAAGTCCTGAGTCAACTCGAGTTGACTCAGGACTTCATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024902.2-1100s1c1
Sequence:CCGGGTTTGTCCTCCTTCTGCCTTACTCGAGTAAGGCAGAAGGAGGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024902.2-1055s1c1
Sequence:CCGGCTTGAATTGGTTCAGCTTCTTCTCGAGAAGAAGCTGAACCAATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024902.2-1508s1c1
Sequence:CCGGCATCCCAACAGAGTTAAAGAACTCGAGTTCTTTAACTCTGTTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_024902.2-1052s1c1
Sequence:CCGGCTTCTTGAATTGGTTCAGCTTCTCGAGAAGCTGAACCAATTCAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024902.2-695s1c1
Sequence:CCGGCCTTTCTTCCATGGTCAACTTCTCGAGAAGTTGACCATGGAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024902.2-650s1c1
Sequence:CCGGCCAGGTGATAGTTGGCATCTACTCGAGTAGATGCCAACTATCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024902.2-904s1c1
Sequence:CCGGGCTACAAAGCTTTGGTGGCATCTCGAGATGCCACCAAAGCTTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024902
VALIDATED
DNAJC22 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 22
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024902.2-1180s21c1
Sequence:CCGGGGGCGAAGCTCTATGAGTTTGCTCGAGCAAACTCATAGAGCTTCGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024902.2-1272s21c1
Sequence:CCGGGAAGAAATACATCGGAGTTACCTCGAGGTAACTCCGATGTATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_024902.2-1377s1c1
Sequence:CCGGGCGTATGAAGTCCTGAGTCAACTCGAGTTGACTCAGGACTTCATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024902.2-1100s1c1
Sequence:CCGGGTTTGTCCTCCTTCTGCCTTACTCGAGTAAGGCAGAAGGAGGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024902.2-1055s1c1
Sequence:CCGGCTTGAATTGGTTCAGCTTCTTCTCGAGAAGAAGCTGAACCAATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024902.2-1508s1c1
Sequence:CCGGCATCCCAACAGAGTTAAAGAACTCGAGTTCTTTAACTCTGTTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_024902.2-1052s1c1
Sequence:CCGGCTTCTTGAATTGGTTCAGCTTCTCGAGAAGCTGAACCAATTCAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024902.2-695s1c1
Sequence:CCGGCCTTTCTTCCATGGTCAACTTCTCGAGAAGTTGACCATGGAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024902.2-650s1c1
Sequence:CCGGCCAGGTGATAGTTGGCATCTACTCGAGTAGATGCCAACTATCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024902.2-904s1c1
Sequence:CCGGGCTACAAAGCTTTGGTGGCATCTCGAGATGCCACCAAAGCTTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024902
VALIDATED
DNAJC22 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 22
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024902.2-1180s21c1
Sequence:CCGGGGGCGAAGCTCTATGAGTTTGCTCGAGCAAACTCATAGAGCTTCGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024902.2-1272s21c1
Sequence:CCGGGAAGAAATACATCGGAGTTACCTCGAGGTAACTCCGATGTATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_024902.2-1377s1c1
Sequence:CCGGGCGTATGAAGTCCTGAGTCAACTCGAGTTGACTCAGGACTTCATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024902.2-1100s1c1
Sequence:CCGGGTTTGTCCTCCTTCTGCCTTACTCGAGTAAGGCAGAAGGAGGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024902.2-1055s1c1
Sequence:CCGGCTTGAATTGGTTCAGCTTCTTCTCGAGAAGAAGCTGAACCAATTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024902.2-1508s1c1
Sequence:CCGGCATCCCAACAGAGTTAAAGAACTCGAGTTCTTTAACTCTGTTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_024902.2-1052s1c1
Sequence:CCGGCTTCTTGAATTGGTTCAGCTTCTCGAGAAGCTGAACCAATTCAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_024902.2-695s1c1
Sequence:CCGGCCTTTCTTCCATGGTCAACTTCTCGAGAAGTTGACCATGGAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024902.2-650s1c1
Sequence:CCGGCCAGGTGATAGTTGGCATCTACTCGAGTAGATGCCAACTATCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024902.2-904s1c1
Sequence:CCGGGCTACAAAGCTTTGGTGGCATCTCGAGATGCCACCAAAGCTTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176835
VALIDATED
DNAJC22 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 22
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176835.2-604s21c1
Sequence:CCGGGTAACCAGACCTCAGACTTTACTCGAGTAAAGTCTGAGGTCTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176835.2-481s21c1
Sequence:CCGGAGATAGTAGTGGGTGTCTATTCTCGAGAATAGACACCCACTACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176835.2-1285s21c1
Sequence:CCGGCTTGTCAGCACCATCCTCAAACTCGAGTTTGAGGATGGTGCTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176835.2-681s21c1
Sequence:CCGGGCCATCCTGCCTATCAGTTTGCTCGAGCAAACTGATAGGCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176835.2-1080s21c1
Sequence:CCGGGTCCCAGAAGGAGCAACTAATCTCGAGATTAGTTGCTCCTTCTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176835.2-720s1c1
Sequence:CCGGCAGAAGCATCGACGATACAAACTCGAGTTTGTATCGTCGATGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176835.2-609s1c1
Sequence:CCGGCAGACCTCAGACTTTAAGAATCTCGAGATTCTTAAAGTCTGAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176835.2-1229s1c1
Sequence:CCGGCAAGAAGCCTAGAGCATCCTACTCGAGTAGGATGCTCTAGGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176835
VALIDATED
DNAJC22 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 22
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176835.2-604s21c1
Sequence:CCGGGTAACCAGACCTCAGACTTTACTCGAGTAAAGTCTGAGGTCTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176835.2-481s21c1
Sequence:CCGGAGATAGTAGTGGGTGTCTATTCTCGAGAATAGACACCCACTACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176835.2-1285s21c1
Sequence:CCGGCTTGTCAGCACCATCCTCAAACTCGAGTTTGAGGATGGTGCTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176835.2-681s21c1
Sequence:CCGGGCCATCCTGCCTATCAGTTTGCTCGAGCAAACTGATAGGCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176835.2-1080s21c1
Sequence:CCGGGTCCCAGAAGGAGCAACTAATCTCGAGATTAGTTGCTCCTTCTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176835.2-720s1c1
Sequence:CCGGCAGAAGCATCGACGATACAAACTCGAGTTTGTATCGTCGATGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176835.2-609s1c1
Sequence:CCGGCAGACCTCAGACTTTAAGAATCTCGAGATTCTTAAAGTCTGAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176835.2-1229s1c1
Sequence:CCGGCAAGAAGCCTAGAGCATCCTACTCGAGTAGGATGCTCTAGGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176835
VALIDATED
DNAJC22 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 22
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176835.2-604s21c1
Sequence:CCGGGTAACCAGACCTCAGACTTTACTCGAGTAAAGTCTGAGGTCTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176835.2-481s21c1
Sequence:CCGGAGATAGTAGTGGGTGTCTATTCTCGAGAATAGACACCCACTACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176835.2-1285s21c1
Sequence:CCGGCTTGTCAGCACCATCCTCAAACTCGAGTTTGAGGATGGTGCTGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176835.2-681s21c1
Sequence:CCGGGCCATCCTGCCTATCAGTTTGCTCGAGCAAACTGATAGGCAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_176835.2-1080s21c1
Sequence:CCGGGTCCCAGAAGGAGCAACTAATCTCGAGATTAGTTGCTCCTTCTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176835.2-720s1c1
Sequence:CCGGCAGAAGCATCGACGATACAAACTCGAGTTTGTATCGTCGATGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176835.2-609s1c1
Sequence:CCGGCAGACCTCAGACTTTAAGAATCTCGAGATTCTTAAAGTCTGAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176835.2-1229s1c1
Sequence:CCGGCAAGAAGCCTAGAGCATCCTACTCGAGTAGGATGCTCTAGGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks