EMAIL THIS PAGE TO A FRIEND

DNAJC24

DnaJ (Hsp40) homolog, subfamily C, member 24

Synonyms: DPH4 JJJ3 ZCSL3
UniProtKB ID: Q6P3W2, A8K0V0, B1ALC1
Gene ID:
Human(120526) Summary: Diphthamide is a unique posttranslationally modified histidine found only in translation elongation factor-2 (EEF2; MIM 130610). This modification is conserved from archaebacteria to humans and serves as the target for ADP-ribosylation and inactivation of EEF2 by diphtheria toxin (DT) and Pseudomonas exotoxin A. DPH4 is 1 of several enzymes involved in synthesis of diphthamide in EEF2 (Liu et al., 2004 [PubMed 15485916]
Mouse(99349) DnaJ (Hsp40) homolog, subfamily C, member 24
Rat(362184) DnaJ (Hsp40) homolog, subfamily C, member 24
domestic guinea pig(100726814) DnaJ (Hsp40) homolog, subfamily C, member 24
naked mole-rat(101710823) DnaJ (Hsp40) homolog, subfamily C, member 24
sheep(101119247) DnaJ (Hsp40) homolog, subfamily C, member 24
Zebrafish(393424) DnaJ (Hsp40) homolog, subfamily C, member 24
chicken(421603) DnaJ (Hsp40) homolog, subfamily C, member 24
dog(100684006) DnaJ (Hsp40) homolog, subfamily C, member 24
cow(768227) DnaJ (Hsp40) homolog, subfamily C, member 24
domestic cat(101086253) DnaJ (Hsp40) homolog, subfamily C, member 24
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026992 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026992 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026992 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181706 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181706 Rosetta Predictions human pricing
XM_001079802 Rosetta Predictions rat pricing
XM_342483 Rosetta Predictions rat pricing
NM_026992 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237686 predicted 495
2 SASI_Hs01_00237687 predicted 399
3 SASI_Hs01_00237689 predicted 390
4 SASI_Hs01_00237690 predicted 422
5 SASI_Hs01_00237691 predicted 272
6 SASI_Hs01_00237692 predicted 516
7 SASI_Hs01_00237693 predicted 597
8 SASI_Hs01_00237694 predicted 641
9 SASI_Hs01_00237688 predicted 294
10 SASI_Hs01_00237695 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365548 predicted 45
2 SASI_Rn02_00365549 predicted 77
3 SASI_Rn02_00365550 predicted 152
4 SASI_Rn02_00365551 predicted 377
5 SASI_Rn02_00365552 predicted 349
6 SASI_Rn02_00365553 predicted 223
7 SASI_Rn02_00365554 predicted 166
8 SASI_Rn02_00365555 predicted 299
9 SASI_Rn02_00365556 predicted 18
10 SASI_Rn02_00365557 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394329 predicted 381
2 SASI_Rn02_00394330 predicted 526
3 SASI_Rn02_00394331 predicted 409
4 SASI_Rn02_00394332 predicted 397
5 SASI_Rn02_00394333 predicted 444
6 SASI_Rn02_00394334 predicted 257
7 SASI_Rn02_00394335 predicted 470
8 SASI_Rn02_00394336 predicted 416
9 SASI_Rn02_00394337 predicted 429
10 SASI_Rn02_00394338 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133005 predicted 795
2 SASI_Mm01_00133006 predicted 646
3 SASI_Mm01_00133007 predicted 550
4 SASI_Mm02_00331348 predicted 949
5 SASI_Mm01_00133008 predicted 635
6 SASI_Mm01_00133009 predicted 547
7 SASI_Mm02_00331349 predicted 905
8 SASI_Mm02_00331350 predicted 885
9 SASI_Mm02_00331351 predicted 805
10 SASI_Mm02_00331352 predicted 809
11 SASI_Mm01_00133010 predicted 500
12 SASI_Mm01_00133011 predicted 723
13 SASI_Mm01_00133012 predicted 591
14 SASI_Mm01_00133013 predicted 668
15 SASI_Mm01_00133014 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026992
DNAJC24 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 24
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026992.1-822s1c1
Sequence:CCGGCTTTCTTTCTGAGCTGTCGATCTCGAGATCGACAGCTCAGAAAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026992.1-674s1c1
Sequence:CCGGGAAATTGATCAGGCATGGAAACTCGAGTTTCCATGCCTGATCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026992.1-739s1c1
Sequence:CCGGGCATGAAGATGAGCTAAGAAACTCGAGTTTCTTAGCTCATCTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026992.1-611s1c1
Sequence:CCGGCCAGATAAACAAAGTGCAGATCTCGAGATCTGCACTTTGTTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026992.1-995s1c1
Sequence:CCGGGTTATTCAAGATGGTCTTCAACTCGAGTTGAAGACCATCTTGAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026992.2-651s1c1
Sequence:CCGGGGAGTGTATGCAGAAGTTTATCTCGAGATAAACTTCTGCATACACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026992.2-981s1c1
Sequence:CCGGCAGATGCTTTCTTGTTATTCACTCGAGTGAATAACAAGAAAGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026992
DNAJC24 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 24
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026992.1-822s1c1
Sequence:CCGGCTTTCTTTCTGAGCTGTCGATCTCGAGATCGACAGCTCAGAAAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026992.1-674s1c1
Sequence:CCGGGAAATTGATCAGGCATGGAAACTCGAGTTTCCATGCCTGATCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026992.1-739s1c1
Sequence:CCGGGCATGAAGATGAGCTAAGAAACTCGAGTTTCTTAGCTCATCTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026992.1-611s1c1
Sequence:CCGGCCAGATAAACAAAGTGCAGATCTCGAGATCTGCACTTTGTTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026992.1-995s1c1
Sequence:CCGGGTTATTCAAGATGGTCTTCAACTCGAGTTGAAGACCATCTTGAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026992.2-651s1c1
Sequence:CCGGGGAGTGTATGCAGAAGTTTATCTCGAGATAAACTTCTGCATACACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026992.2-981s1c1
Sequence:CCGGCAGATGCTTTCTTGTTATTCACTCGAGTGAATAACAAGAAAGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026992
DNAJC24 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 24
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026992.1-822s1c1
Sequence:CCGGCTTTCTTTCTGAGCTGTCGATCTCGAGATCGACAGCTCAGAAAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026992.1-674s1c1
Sequence:CCGGGAAATTGATCAGGCATGGAAACTCGAGTTTCCATGCCTGATCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026992.1-739s1c1
Sequence:CCGGGCATGAAGATGAGCTAAGAAACTCGAGTTTCTTAGCTCATCTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026992.1-611s1c1
Sequence:CCGGCCAGATAAACAAAGTGCAGATCTCGAGATCTGCACTTTGTTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026992.1-995s1c1
Sequence:CCGGGTTATTCAAGATGGTCTTCAACTCGAGTTGAAGACCATCTTGAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026992.2-651s1c1
Sequence:CCGGGGAGTGTATGCAGAAGTTTATCTCGAGATAAACTTCTGCATACACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216114    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026992.2-981s1c1
Sequence:CCGGCAGATGCTTTCTTGTTATTCACTCGAGTGAATAACAAGAAAGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181706
VALIDATED
DNAJC24 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 24
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181706.3-186s1c1
Sequence:CCGGCAAAGTACAGATGTACCAGCACTCGAGTGCTGGTACATCTGTACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181706.3-426s1c1
Sequence:CCGGGTTTCCAAGGATGAAGCGGAACTCGAGTTCCGCTTCATCCTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181706.3-442s1c1
Sequence:CCGGCGGAAGAAGTTAGCCTGATTTCTCGAGAAATCAGGCTAACTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181706.3-890s1c1
Sequence:CCGGCGTTTCTAGTTGCTAAAGTTACTCGAGTAACTTTAGCAACTAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181706.3-450s1c1
Sequence:CCGGGTTAGCCTGATTTCTTGTGATCTCGAGATCACAAGAAATCAGGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181706.3-360s1c1
Sequence:CCGGGAAATGTCTTGGAATGAAGGTCTCGAGACCTTCATTCCAAGACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181706.3-315s1c1
Sequence:CCGGGATCTAAGAAATGTAGGACCACTCGAGTGGTCCTACATTTCTTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181706.4-425s21c1
Sequence:CCGGTTGGAATGAAGGTGATCACTCCTCGAGGAGTGATCACCTTCATTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181706.4-281s21c1
Sequence:CCGGTGTACAGAAGTTCATCGAAATCTCGAGATTTCGATGAACTTCTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181706.4-389s21c1
Sequence:CCGGACCAGTAGATGCTCAAGTATACTCGAGTATACTTGAGCATCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181706.4-889s21c1
Sequence:CCGGTGGGTAACAGTATCATCATATCTCGAGATATGATGATACTGTTACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181706.4-652s21c1
Sequence:CCGGTATTTGTCAGCCCGATTATTTCTCGAGAAATAATCGGGCTGACAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181706.4-523s21c1
Sequence:CCGGGTGATACATGTTCACTAATTACTCGAGTAATTAGTGAACATGTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181706.4-169s21c1
Sequence:CCGGCAGACCCATCTGCAAATATATCTCGAGATATATTTGCAGATGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181706
VALIDATED
DNAJC24 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 24
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181706.3-186s1c1
Sequence:CCGGCAAAGTACAGATGTACCAGCACTCGAGTGCTGGTACATCTGTACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181706.3-426s1c1
Sequence:CCGGGTTTCCAAGGATGAAGCGGAACTCGAGTTCCGCTTCATCCTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181706.3-442s1c1
Sequence:CCGGCGGAAGAAGTTAGCCTGATTTCTCGAGAAATCAGGCTAACTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181706.3-890s1c1
Sequence:CCGGCGTTTCTAGTTGCTAAAGTTACTCGAGTAACTTTAGCAACTAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181706.3-450s1c1
Sequence:CCGGGTTAGCCTGATTTCTTGTGATCTCGAGATCACAAGAAATCAGGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181706.3-360s1c1
Sequence:CCGGGAAATGTCTTGGAATGAAGGTCTCGAGACCTTCATTCCAAGACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181706.3-315s1c1
Sequence:CCGGGATCTAAGAAATGTAGGACCACTCGAGTGGTCCTACATTTCTTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181706.4-425s21c1
Sequence:CCGGTTGGAATGAAGGTGATCACTCCTCGAGGAGTGATCACCTTCATTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181706.4-281s21c1
Sequence:CCGGTGTACAGAAGTTCATCGAAATCTCGAGATTTCGATGAACTTCTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181706.4-389s21c1
Sequence:CCGGACCAGTAGATGCTCAAGTATACTCGAGTATACTTGAGCATCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181706.4-889s21c1
Sequence:CCGGTGGGTAACAGTATCATCATATCTCGAGATATGATGATACTGTTACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181706.4-652s21c1
Sequence:CCGGTATTTGTCAGCCCGATTATTTCTCGAGAAATAATCGGGCTGACAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181706.4-523s21c1
Sequence:CCGGGTGATACATGTTCACTAATTACTCGAGTAATTAGTGAACATGTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181706.4-169s21c1
Sequence:CCGGCAGACCCATCTGCAAATATATCTCGAGATATATTTGCAGATGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181706
VALIDATED
DNAJC24 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 24
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181706.3-186s1c1
Sequence:CCGGCAAAGTACAGATGTACCAGCACTCGAGTGCTGGTACATCTGTACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181706.3-426s1c1
Sequence:CCGGGTTTCCAAGGATGAAGCGGAACTCGAGTTCCGCTTCATCCTTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181706.3-442s1c1
Sequence:CCGGCGGAAGAAGTTAGCCTGATTTCTCGAGAAATCAGGCTAACTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181706.3-890s1c1
Sequence:CCGGCGTTTCTAGTTGCTAAAGTTACTCGAGTAACTTTAGCAACTAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181706.3-450s1c1
Sequence:CCGGGTTAGCCTGATTTCTTGTGATCTCGAGATCACAAGAAATCAGGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181706.3-360s1c1
Sequence:CCGGGAAATGTCTTGGAATGAAGGTCTCGAGACCTTCATTCCAAGACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181706.3-315s1c1
Sequence:CCGGGATCTAAGAAATGTAGGACCACTCGAGTGGTCCTACATTTCTTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181706.4-425s21c1
Sequence:CCGGTTGGAATGAAGGTGATCACTCCTCGAGGAGTGATCACCTTCATTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181706.4-281s21c1
Sequence:CCGGTGTACAGAAGTTCATCGAAATCTCGAGATTTCGATGAACTTCTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181706.4-389s21c1
Sequence:CCGGACCAGTAGATGCTCAAGTATACTCGAGTATACTTGAGCATCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181706.4-889s21c1
Sequence:CCGGTGGGTAACAGTATCATCATATCTCGAGATATGATGATACTGTTACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181706.4-652s21c1
Sequence:CCGGTATTTGTCAGCCCGATTATTTCTCGAGAAATAATCGGGCTGACAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181706.4-523s21c1
Sequence:CCGGGTGATACATGTTCACTAATTACTCGAGTAATTAGTGAACATGTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181706.4-169s21c1
Sequence:CCGGCAGACCCATCTGCAAATATATCTCGAGATATATTTGCAGATGGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks