EMAIL THIS PAGE TO A FRIEND

DNAJC25-GNG10

DNAJC25-GNG10 readthrough

18 Gene Product Result for
Gene ID:
Human(552891) Summary: This gene represents naturally-occurring mRNAs that are co-transcribed products of the neighboring DNAJC25 and GNG10 genes. These transcripts include the first exon of DNAJC25 and the last two exons of GNG10, resulting in a protein that combines the N-terminus of DNAJC25 and the C-terminus of GNG10. [provided by RefSeq, Dec 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA019122 Anti-DNAJC25 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2101368 Anti-LOC552891 antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, mouse, rat, bovine, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004125 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004125 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247291 predicted 976
2 SASI_Hs01_00247292 predicted 734
3 SASI_Hs01_00247293 predicted 760
4 SASI_Hs01_00247294 predicted 508
5 SASI_Hs01_00247295 predicted 659
6 SASI_Hs01_00247296 predicted 884
7 SASI_Hs01_00247297 predicted 782
8 SASI_Hs01_00247298 predicted 812
9 SASI_Hs01_00247299 predicted 532
10 SASI_Hs01_00247300 predicted 426
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004125
DNAJC25-GNG10 MISSION shRNA Bacterial Glycerol Stock
DNAJC25-GNG10 readthrough
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004125.2-458s1c1
Sequence:CCGGGAGCCTAGATCCTGTGCTTTACTCGAGTAAAGCACAGGATCTAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004125.2-383s1c1
Sequence:CCGGCAACAGTACTGTATGCAGAATCTCGAGATTCTGCATACAGTACTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004125.2-244s1c1
Sequence:CCGGGCGCTACCACCCTGACCGCTACTCGAGTAGCGGTCAGGGTGGTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004125.2-391s1c1
Sequence:CCGGCTGTATGCAGAATGCCTGCAACTCGAGTTGCAGGCATTCTGCATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004125.2-340s1c1
Sequence:CCGGCGCCTACGAGACACTCAAGGTCTCGAGACCTTGAGTGTCTCGTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004125
DNAJC25-GNG10 MISSION shRNA shRNA Plasmid DNA
DNAJC25-GNG10 readthrough
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004125.2-458s1c1
Sequence:CCGGGAGCCTAGATCCTGTGCTTTACTCGAGTAAAGCACAGGATCTAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004125.2-383s1c1
Sequence:CCGGCAACAGTACTGTATGCAGAATCTCGAGATTCTGCATACAGTACTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004125.2-244s1c1
Sequence:CCGGGCGCTACCACCCTGACCGCTACTCGAGTAGCGGTCAGGGTGGTAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004125.2-391s1c1
Sequence:CCGGCTGTATGCAGAATGCCTGCAACTCGAGTTGCAGGCATTCTGCATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004125.2-340s1c1
Sequence:CCGGCGCCTACGAGACACTCAAGGTCTCGAGACCTTGAGTGTCTCGTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004125
DNAJC25-GNG10 MISSION shRNA Lentiviral Transduction Particles
DNAJC25-GNG10 readthrough
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004125.2-458s1c1
Sequence:CCGGGAGCCTAGATCCTGTGCTTTACTCGAGTAAAGCACAGGATCTAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004125.2-383s1c1
Sequence:CCGGCAACAGTACTGTATGCAGAATCTCGAGATTCTGCATACAGTACTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004125.2-244s1c1
Sequence:CCGGGCGCTACCACCCTGACCGCTACTCGAGTAGCGGTCAGGGTGGTAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004125.2-391s1c1
Sequence:CCGGCTGTATGCAGAATGCCTGCAACTCGAGTTGCAGGCATTCTGCATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004125.2-340s1c1
Sequence:CCGGCGCCTACGAGACACTCAAGGTCTCGAGACCTTGAGTGTCTCGTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)