EMAIL THIS PAGE TO A FRIEND

DNAJC25

DnaJ (Hsp40) homolog, subfamily C , member 25

120 Gene Product Result for
Synonyms: bA16L21.2.1
UniProtKB ID: Q9H1X3, Q5QTD8, Q96BN9
Gene ID:
Mouse(72429) DnaJ (Hsp40) homolog, subfamily C, member 25
Rat(362526) DnaJ (Hsp40) homolog, subfamily C, member 25
Zebrafish(100319235) DnaJ (Hsp40) homolog, subfamily C , member 25
cow(535430) DnaJ (Hsp40) homolog, subfamily C , member 25
domestic cat(101093721) DnaJ (Hsp40) homolog, subfamily C , member 25
dog(481665) DnaJ (Hsp40) homolog, subfamily C , member 25
chicken(431639) DnaJ (Hsp40) homolog, subfamily C , member 25
sheep(101121664) DnaJ (Hsp40) homolog, subfamily C , member 25
Domestic Rabbit(100343945) DnaJ (Hsp40) homolog, subfamily C , member 25
naked mole-rat(101717079) DnaJ (Hsp40) homolog, subfamily C , member 25
domestic guinea pig(100730599) DnaJ (Hsp40) homolog, subfamily C , member 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105603 Anti-DNAJC25 antibody produced in rabbit affinity isolated antibody horse, rabbit, guinea pig, human
western blot pricing
SAB2106685 Anti-DNAJC25 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rabbit, horse, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001015882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001015882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001015882 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033165 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033165 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033165 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU214971 MISSION® esiRNA esiRNA targeting mouse Dnajc25 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015882 Rosetta Predictions human pricing
NM_001025021 Rosetta Predictions rat pricing
NM_001033165 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234349 predicted 1590
2 SASI_Hs01_00234350 predicted 897
3 SASI_Hs01_00234352 predicted 1020
4 SASI_Hs01_00234353 predicted 1150
5 SASI_Hs01_00234354 predicted 1602
6 SASI_Hs02_00306670 predicted 1521
7 SASI_Hs02_00306671 predicted 1372
8 SASI_Hs01_00234355 predicted 1483
9 SASI_Hs01_00234356 predicted 1079
10 SASI_Hs01_00234357 predicted 1521
11 SASI_Hs01_00234348 predicted 1667
12 SASI_Hs01_00234351 predicted 1771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031587 predicted 389
2 SASI_Rn01_00031588 predicted 391
3 SASI_Rn01_00031589 predicted 367
4 SASI_Rn01_00031590 predicted 950
5 SASI_Rn01_00031591 predicted 343
6 SASI_Rn01_00031592 predicted 992
7 SASI_Rn01_00031593 predicted 277
8 SASI_Rn02_00202934 predicted 362
9 SASI_Rn01_00031595 predicted 1007
10 SASI_Rn02_00202935 predicted 241
11 SASI_Rn01_00031586 predicted 961
12 SASI_Rn01_00031594 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033165 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137124 predicted 695
2 SASI_Mm01_00137126 predicted 677
3 SASI_Mm01_00137127 predicted 837
4 SASI_Mm01_00137128 predicted 824
5 SASI_Mm01_00137129 predicted 877
6 SASI_Mm01_00137130 predicted 692
7 SASI_Mm01_00137131 predicted 555
8 SASI_Mm02_00288254 predicted 655
9 SASI_Mm01_00137132 predicted 726
10 SASI_Mm02_00288255 predicted 826
11 SASI_Mm01_00137125 predicted 560
12 SASI_Mm01_00137133 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001015882
VALIDATED
DNAJC25 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C , member 25
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015882.2-1154s21c1
Sequence:CCGGCTACTATGCCAAACCTTAATTCTCGAGAATTAAGGTTTGGCATAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015882.2-451s21c1
Sequence:CCGGGCCATTACTACCACTACTATACTCGAGTATAGTAGTGGTAGTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015882.2-816s21c1
Sequence:CCGGTTTCACCTATGCTCATATATACTCGAGTATATATGAGCATAGGTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015882.2-841s21c1
Sequence:CCGGGGTATTGTCGGTGGATCTATACTCGAGTATAGATCCACCGACAATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015882.2-514s21c1
Sequence:CCGGTGGTCAGCGTGTGTGCTATTTCTCGAGAAATAGCACACACGCTGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015882.1-767s1c1
Sequence:CCGGGAATAGCTACAATAAGGCAATCTCGAGATTGCCTTATTGTAGCTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001015882
VALIDATED
DNAJC25 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C , member 25
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015882.2-1154s21c1
Sequence:CCGGCTACTATGCCAAACCTTAATTCTCGAGAATTAAGGTTTGGCATAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015882.2-451s21c1
Sequence:CCGGGCCATTACTACCACTACTATACTCGAGTATAGTAGTGGTAGTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015882.2-816s21c1
Sequence:CCGGTTTCACCTATGCTCATATATACTCGAGTATATATGAGCATAGGTGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015882.2-841s21c1
Sequence:CCGGGGTATTGTCGGTGGATCTATACTCGAGTATAGATCCACCGACAATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015882.2-514s21c1
Sequence:CCGGTGGTCAGCGTGTGTGCTATTTCTCGAGAAATAGCACACACGCTGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015882.1-767s1c1
Sequence:CCGGGAATAGCTACAATAAGGCAATCTCGAGATTGCCTTATTGTAGCTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001015882
VALIDATED
DNAJC25 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C , member 25
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015882.2-1154s21c1
Sequence:CCGGCTACTATGCCAAACCTTAATTCTCGAGAATTAAGGTTTGGCATAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015882.2-451s21c1
Sequence:CCGGGCCATTACTACCACTACTATACTCGAGTATAGTAGTGGTAGTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015882.2-816s21c1
Sequence:CCGGTTTCACCTATGCTCATATATACTCGAGTATATATGAGCATAGGTGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015882.2-841s21c1
Sequence:CCGGGGTATTGTCGGTGGATCTATACTCGAGTATAGATCCACCGACAATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015882.2-514s21c1
Sequence:CCGGTGGTCAGCGTGTGTGCTATTTCTCGAGAAATAGCACACACGCTGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015882.1-767s1c1
Sequence:CCGGGAATAGCTACAATAAGGCAATCTCGAGATTGCCTTATTGTAGCTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033165
DNAJC25 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C , member 25
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033165.2-845s21c1
Sequence:CCGGCGACACTTGCATAGCAGTAACCTCGAGGTTACTGCTATGCAAGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033165.2-483s21c1
Sequence:CCGGGTTCACCTGTGCTCTTATATACTCGAGTATATAAGAGCACAGGTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033165.2-650s21c1
Sequence:CCGGCAAGCGGGAGCTTTGGATAAACTCGAGTTTATCCAAAGCTCCCGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033165.2-445s21c1
Sequence:CCGGTTCGGGACCTCCTCTTGTTTCCTCGAGGAAACAAGAGGAGGTCCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033165.2-508s21c1
Sequence:CCGGGGTATTGTAGGTGGATCTATACTCGAGTATAGATCCACCTACAATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033165
DNAJC25 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C , member 25
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033165.2-845s21c1
Sequence:CCGGCGACACTTGCATAGCAGTAACCTCGAGGTTACTGCTATGCAAGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033165.2-483s21c1
Sequence:CCGGGTTCACCTGTGCTCTTATATACTCGAGTATATAAGAGCACAGGTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033165.2-650s21c1
Sequence:CCGGCAAGCGGGAGCTTTGGATAAACTCGAGTTTATCCAAAGCTCCCGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033165.2-445s21c1
Sequence:CCGGTTCGGGACCTCCTCTTGTTTCCTCGAGGAAACAAGAGGAGGTCCCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033165.2-508s21c1
Sequence:CCGGGGTATTGTAGGTGGATCTATACTCGAGTATAGATCCACCTACAATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033165
DNAJC25 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C , member 25
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033165.2-845s21c1
Sequence:CCGGCGACACTTGCATAGCAGTAACCTCGAGGTTACTGCTATGCAAGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033165.2-483s21c1
Sequence:CCGGGTTCACCTGTGCTCTTATATACTCGAGTATATAAGAGCACAGGTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033165.2-650s21c1
Sequence:CCGGCAAGCGGGAGCTTTGGATAAACTCGAGTTTATCCAAAGCTCCCGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033165.2-445s21c1
Sequence:CCGGTTCGGGACCTCCTCTTGTTTCCTCGAGGAAACAAGAGGAGGTCCCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033165.2-508s21c1
Sequence:CCGGGGTATTGTAGGTGGATCTATACTCGAGTATAGATCCACCTACAATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)