EMAIL THIS PAGE TO A FRIEND

DNAJC27

DnaJ (Hsp40) homolog, subfamily C, member 27

146 Gene Product Result for
Synonyms: RBJ RabJS
UniProtKB ID: Q9NZQ0, Q5JV88, Q86Y24
Gene ID:
Mouse(217378) DnaJ (Hsp40) homolog, subfamily C, member 27
Rat(298859) DnaJ (Hsp40) homolog, subfamily C, member 27
Zebrafish(402784) DnaJ (Hsp40) homolog, subfamily C, member 27
domestic cat(101087732) DnaJ (Hsp40) homolog, subfamily C, member 27
cow(540033) DnaJ (Hsp40) homolog, subfamily C, member 27
Horse(100055919) DnaJ (Hsp40) homolog, subfamily C, member 27
dog(482995) DnaJ (Hsp40) homolog, subfamily C, member 27
chicken(402783) DnaJ (Hsp40) homolog, subfamily C, member 27
domestic guinea pig(100726488) DnaJ (Hsp40) homolog, subfamily C, member 27
naked mole-rat(101717374) DnaJ (Hsp40) homolog, subfamily C, member 27
sheep(101108467) DnaJ (Hsp40) homolog, subfamily C, member 27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016544 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016544 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016544 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153082 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153082 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153082 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016544 Rosetta Predictions human pricing
NM_206845 Rosetta Predictions rat pricing
NM_153082 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133639 predicted 210
2 SASI_Hs01_00133640 predicted 742
3 SASI_Hs02_00349658 predicted 274
4 SASI_Hs01_00133641 predicted 674
5 SASI_Hs01_00133642 predicted 584
6 SASI_Hs02_00349659 predicted 493
7 SASI_Hs01_00133643 predicted 333
8 SASI_Hs01_00133644 predicted 452
9 SASI_Hs01_00133646 predicted 201
10 SASI_Hs02_00349660 predicted 913
11 SASI_Hs01_00133645 predicted 965
12 SASI_Hs01_00133647 predicted 465
13 SASI_Hs01_00133648 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206845 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270373 predicted 473
2 SASI_Rn02_00270374 predicted 456
3 SASI_Rn02_00270375 predicted 481
4 SASI_Rn02_00270376 predicted 498
5 SASI_Rn02_00270377 predicted 392
6 SASI_Rn02_00270378 predicted 386
7 SASI_Rn02_00270379 predicted 689
8 SASI_Rn02_00270380 predicted 726
9 SASI_Rn02_00270381 predicted 715
10 SASI_Rn02_00270382 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130024 predicted 788
2 SASI_Mm01_00130025 predicted 1087
3 SASI_Mm02_00342913 predicted 330
4 SASI_Mm01_00130031 predicted 439
5 SASI_Mm01_00130032 predicted 662
6 SASI_Mm01_00130033 predicted 255
7 SASI_Mm02_00342914 predicted 361
8 SASI_Mm02_00342915 predicted 280
9 SASI_Mm02_00342916 predicted 534
10 SASI_Mm02_00342917 predicted 714
11 SASI_Mm01_00130026 predicted 918
12 SASI_Mm01_00130027 predicted 798
13 SASI_Mm01_00130028 predicted 1002
14 SASI_Mm01_00130029 predicted 456
15 SASI_Mm01_00130030 predicted 935
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016544
VALIDATED
DNAJC27 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 27
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016544.1-734s1c1
Sequence:CCGGCCTCAAGGGATGAAGTCAATACTCGAGTATTGACTTCATCCCTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_016544.1-268s1c1
Sequence:CCGGGCTGGACATCCCTTCTTCTATCTCGAGATAGAAGAAGGGATGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016544.1-820s1c1
Sequence:CCGGGCCTTCAAAGCAGTTGTGAATCTCGAGATTCACAACTGCTTTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016544.1-334s1c1
Sequence:CCGGGTCTATGATGTTGGGCAGAAACTCGAGTTTCTGCCCAACATCATAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016544.1-667s1c1
Sequence:CCGGGCAGATGCCATTCGCAGAATTCTCGAGAATTCTGCGAATGGCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016544.1-444s21c1
Sequence:GTACCGGTTGTGCCAACAAGATTGATTGCTCGAGCAATCAATCTTGTTGGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016544.1-281s21c1
Sequence:GTACCGGTCTTCTATGAGGTTCGAAATGCTCGAGCATTTCGAACCTCATAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016544.1-178s21c1
Sequence:GTACCGGTCTAAATACCTGGCAACAATTCTCGAGAATTGTTGCCAGGTATTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016544.1-4680s21c1
Sequence:CCGGTGTGAAAGCAGAGTCTATAAACTCGAGTTTATAGACTCTGCTTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016544.1-634s21c1
Sequence:CCGGACCAATAGCAGTGCTAGTTTCCTCGAGGAAACTAGCACTGCTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016544
VALIDATED
DNAJC27 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 27
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016544.1-734s1c1
Sequence:CCGGCCTCAAGGGATGAAGTCAATACTCGAGTATTGACTTCATCCCTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_016544.1-268s1c1
Sequence:CCGGGCTGGACATCCCTTCTTCTATCTCGAGATAGAAGAAGGGATGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016544.1-820s1c1
Sequence:CCGGGCCTTCAAAGCAGTTGTGAATCTCGAGATTCACAACTGCTTTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016544.1-334s1c1
Sequence:CCGGGTCTATGATGTTGGGCAGAAACTCGAGTTTCTGCCCAACATCATAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016544.1-667s1c1
Sequence:CCGGGCAGATGCCATTCGCAGAATTCTCGAGAATTCTGCGAATGGCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016544.1-444s21c1
Sequence:GTACCGGTTGTGCCAACAAGATTGATTGCTCGAGCAATCAATCTTGTTGGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016544.1-281s21c1
Sequence:GTACCGGTCTTCTATGAGGTTCGAAATGCTCGAGCATTTCGAACCTCATAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016544.1-178s21c1
Sequence:GTACCGGTCTAAATACCTGGCAACAATTCTCGAGAATTGTTGCCAGGTATTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016544.1-4680s21c1
Sequence:CCGGTGTGAAAGCAGAGTCTATAAACTCGAGTTTATAGACTCTGCTTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016544.1-634s21c1
Sequence:CCGGACCAATAGCAGTGCTAGTTTCCTCGAGGAAACTAGCACTGCTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016544
VALIDATED
DNAJC27 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 27
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016544.1-734s1c1
Sequence:CCGGCCTCAAGGGATGAAGTCAATACTCGAGTATTGACTTCATCCCTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_016544.1-268s1c1
Sequence:CCGGGCTGGACATCCCTTCTTCTATCTCGAGATAGAAGAAGGGATGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016544.1-820s1c1
Sequence:CCGGGCCTTCAAAGCAGTTGTGAATCTCGAGATTCACAACTGCTTTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016544.1-334s1c1
Sequence:CCGGGTCTATGATGTTGGGCAGAAACTCGAGTTTCTGCCCAACATCATAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016544.1-667s1c1
Sequence:CCGGGCAGATGCCATTCGCAGAATTCTCGAGAATTCTGCGAATGGCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016544.1-444s21c1
Sequence:GTACCGGTTGTGCCAACAAGATTGATTGCTCGAGCAATCAATCTTGTTGGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016544.1-281s21c1
Sequence:GTACCGGTCTTCTATGAGGTTCGAAATGCTCGAGCATTTCGAACCTCATAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016544.1-178s21c1
Sequence:GTACCGGTCTAAATACCTGGCAACAATTCTCGAGAATTGTTGCCAGGTATTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016544.1-4680s21c1
Sequence:CCGGTGTGAAAGCAGAGTCTATAAACTCGAGTTTATAGACTCTGCTTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016544.1-634s21c1
Sequence:CCGGACCAATAGCAGTGCTAGTTTCCTCGAGGAAACTAGCACTGCTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153082
VALIDATED
DNAJC27 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 27
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153082.2-3775s1c1
Sequence:CCGGGCTTGTATTTACCTCAGGAAACTCGAGTTTCCTGAGGTAAATACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153082.2-402s1c1
Sequence:CCGGCCTTCTTCTTTGAGGTCCGAACTCGAGTTCGGACCTCAAAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153082.2-277s1c1
Sequence:CCGGGCGCTACTGTGAGAAGAGATTCTCGAGAATCTCTTCTCACAGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153082.2-717s1c1
Sequence:CCGGCCATAGTTGACTTGTGTGAAACTCGAGTTTCACACAAGTCAACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153082.2-536s1c1
Sequence:CCGGCACGGGAACATGGACAACATTCTCGAGAATGTTGTCCATGTTCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153082.3-315s21c1
Sequence:CCGGCAACCATCGGGATTGACTATGCTCGAGCATAGTCAATCCCGATGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153082.3-537s21c1
Sequence:CCGGACGGGAACATGGACAACATTGCTCGAGCAATGTTGTCCATGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153082.3-595s21c1
Sequence:CCGGACACCGCTGCATCGATGAAAGCTCGAGCTTTCATCGATGCAGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153082.3-799s21c1
Sequence:CCGGTATTCGCAGAATCCGAAATAGCTCGAGCTATTTCGGATTCTGCGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153082.3-1400s21c1
Sequence:CCGGAGCGGCTTCCTGGTTAGTATTCTCGAGAATACTAACCAGGAAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153082
VALIDATED
DNAJC27 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 27
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153082.2-3775s1c1
Sequence:CCGGGCTTGTATTTACCTCAGGAAACTCGAGTTTCCTGAGGTAAATACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153082.2-402s1c1
Sequence:CCGGCCTTCTTCTTTGAGGTCCGAACTCGAGTTCGGACCTCAAAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153082.2-277s1c1
Sequence:CCGGGCGCTACTGTGAGAAGAGATTCTCGAGAATCTCTTCTCACAGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153082.2-717s1c1
Sequence:CCGGCCATAGTTGACTTGTGTGAAACTCGAGTTTCACACAAGTCAACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153082.2-536s1c1
Sequence:CCGGCACGGGAACATGGACAACATTCTCGAGAATGTTGTCCATGTTCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153082.3-315s21c1
Sequence:CCGGCAACCATCGGGATTGACTATGCTCGAGCATAGTCAATCCCGATGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153082.3-537s21c1
Sequence:CCGGACGGGAACATGGACAACATTGCTCGAGCAATGTTGTCCATGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153082.3-595s21c1
Sequence:CCGGACACCGCTGCATCGATGAAAGCTCGAGCTTTCATCGATGCAGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153082.3-799s21c1
Sequence:CCGGTATTCGCAGAATCCGAAATAGCTCGAGCTATTTCGGATTCTGCGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153082.3-1400s21c1
Sequence:CCGGAGCGGCTTCCTGGTTAGTATTCTCGAGAATACTAACCAGGAAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153082
VALIDATED
DNAJC27 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 27
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153082.2-3775s1c1
Sequence:CCGGGCTTGTATTTACCTCAGGAAACTCGAGTTTCCTGAGGTAAATACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153082.2-402s1c1
Sequence:CCGGCCTTCTTCTTTGAGGTCCGAACTCGAGTTCGGACCTCAAAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153082.2-277s1c1
Sequence:CCGGGCGCTACTGTGAGAAGAGATTCTCGAGAATCTCTTCTCACAGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153082.2-717s1c1
Sequence:CCGGCCATAGTTGACTTGTGTGAAACTCGAGTTTCACACAAGTCAACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153082.2-536s1c1
Sequence:CCGGCACGGGAACATGGACAACATTCTCGAGAATGTTGTCCATGTTCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153082.3-315s21c1
Sequence:CCGGCAACCATCGGGATTGACTATGCTCGAGCATAGTCAATCCCGATGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153082.3-537s21c1
Sequence:CCGGACGGGAACATGGACAACATTGCTCGAGCAATGTTGTCCATGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_153082.3-595s21c1
Sequence:CCGGACACCGCTGCATCGATGAAAGCTCGAGCTTTCATCGATGCAGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153082.3-799s21c1
Sequence:CCGGTATTCGCAGAATCCGAAATAGCTCGAGCTATTTCGGATTCTGCGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153082.3-1400s21c1
Sequence:CCGGAGCGGCTTCCTGGTTAGTATTCTCGAGAATACTAACCAGGAAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks