EMAIL THIS PAGE TO A FRIEND

DNAJC28

DnaJ (Hsp40) homolog, subfamily C, member 28

74 Gene Product Result for
Synonyms: C21orf55 C21orf78
UniProtKB ID: Q9NX36, D3DSF2
Gene ID:
Mouse(246738) DnaJ (Hsp40) homolog, subfamily C, member 28
Rat(360699) DnaJ (Hsp40) homolog, subfamily C, member 28
Zebrafish(550341) DnaJ (Hsp40) homolog, subfamily C, member 28
cow(784171) DnaJ (Hsp40) homolog, subfamily C, member 28
Horse(100052371) DnaJ (Hsp40) homolog, subfamily C, member 28
domestic cat(101088020) DnaJ (Hsp40) homolog, subfamily C, member 28
dog(100688021) DnaJ (Hsp40) homolog, subfamily C, member 28
sheep(101121989) DnaJ (Hsp40) homolog, subfamily C, member 28
Domestic Rabbit(100328907) DnaJ (Hsp40) homolog, subfamily C, member 28
naked mole-rat(101726233) DnaJ (Hsp40) homolog, subfamily C, member 28
domestic guinea pig(100726609) DnaJ (Hsp40) homolog, subfamily C, member 28
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017833 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130311 MISSION® esiRNA esiRNA human DNAJC28 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040192 Rosetta Predictions human pricing
NM_017833 Rosetta Predictions human pricing
NM_001014124 Rosetta Predictions rat pricing
NM_001099738 Rosetta Predictions mouse pricing
NM_138664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086360 predicted 1242
2 SASI_Hs01_00086361 predicted 1238
3 SASI_Hs01_00086362 predicted 331
4 SASI_Hs01_00086364 predicted 989
5 SASI_Hs01_00086365 predicted 1204
6 SASI_Hs01_00086367 predicted 471
7 SASI_Hs01_00086368 predicted 749
8 SASI_Hs01_00086369 predicted 878
9 SASI_Hs02_00308895 predicted 1189
10 SASI_Hs02_00308896 predicted 737
11 SASI_Hs01_00086363 predicted 1194
12 SASI_Hs01_00086366 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210010 predicted 1544
2 SASI_Hs01_00210011 predicted 1543
3 SASI_Hs01_00210012 predicted 633
4 SASI_Hs01_00210014 predicted 1290
5 SASI_Hs01_00210015 predicted 1504
6 SASI_Hs01_00210017 predicted 775
7 SASI_Hs01_00210018 predicted 1051
8 SASI_Hs01_00210019 predicted 1181
9 SASI_Hs02_00350714 predicted 1490
10 SASI_Hs02_00350715 predicted 1040
11 SASI_Hs01_00210013 predicted 1496
12 SASI_Hs01_00210016 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094471 predicted 1148
2 SASI_Rn01_00094472 predicted 338
3 SASI_Rn01_00094473 predicted 780
4 SASI_Rn01_00094474 predicted 281
5 SASI_Rn01_00094475 predicted 423
6 SASI_Rn01_00094476 predicted 1164
7 SASI_Rn01_00094477 predicted 966
8 SASI_Rn01_00094478 predicted 289
9 SASI_Rn01_00094479 predicted 633
10 SASI_Rn01_00094480 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301995 predicted 963
2 SASI_Mm02_00301996 predicted 1361
3 SASI_Mm02_00301997 predicted 1166
4 SASI_Mm02_00301998 predicted 830
5 SASI_Mm02_00301999 predicted 1457
6 SASI_Mm02_00302000 predicted 975
7 SASI_Mm02_00302001 predicted 1534
8 SASI_Mm02_00302002 predicted 1563
9 SASI_Mm02_00302003 predicted 1347
10 SASI_Mm02_00302004 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339732 predicted 791
2 SASI_Mm01_00040984 predicted 1187
3 SASI_Mm01_00040986 predicted 989
4 SASI_Mm01_00040988 predicted 664
5 SASI_Mm01_00040989 predicted 1288
6 SASI_Mm01_00040990 predicted 809
7 SASI_Mm01_00040991 predicted 1363
8 SASI_Mm01_00040992 predicted 1386
9 SASI_Mm01_00040993 predicted 1178
10 SASI_Mm02_00339733 predicted 708
11 SASI_Mm01_00040985 predicted 632
12 SASI_Mm01_00040987 predicted 438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017833
DNAJC28 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 28
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017833.3-663s21c1
Sequence:CCGGCATAAGCTTGCCAAGCAATATCTCGAGATATTGCTTGGCAAGCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017833.3-1038s21c1
Sequence:CCGGACGCAAGCTATAGAACGTTTACTCGAGTAAACGTTCTATAGCTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017833.3-1699s21c1
Sequence:CCGGGAATTGTGCCATTGTACTTATCTCGAGATAAGTACAATGGCACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017833.3-1205s21c1
Sequence:CCGGCCAACCAGAATGGATCCTTAACTCGAGTTAAGGATCCATTCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017833.2-878s1c1
Sequence:CCGGCCAACTCAACGAGAGAAGCATCTCGAGATGCTTCTCTCGTTGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017833.2-929s1c1
Sequence:CCGGGAACAAGTGATGGAATATCAACTCGAGTTGATATTCCATCACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162104    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017833.2-1635s1c1
Sequence:CCGGCCACTGACACTTTACATGGAACTCGAGTTCCATGTAAAGTGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017833.2-484s1c1
Sequence:CCGGCCTGATAAAGGCTACAGTGATCTCGAGATCACTGTAGCCTTTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017833.2-630s1c1
Sequence:CCGGCAGATGAAGTCAGGGAATCTTCTCGAGAAGATTCCCTGACTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017833.2-1156s1c1
Sequence:CCGGGACTCACAACCTGAACCGAATCTCGAGATTCGGTTCAGGTTGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017833
DNAJC28 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 28
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017833.3-663s21c1
Sequence:CCGGCATAAGCTTGCCAAGCAATATCTCGAGATATTGCTTGGCAAGCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017833.3-1038s21c1
Sequence:CCGGACGCAAGCTATAGAACGTTTACTCGAGTAAACGTTCTATAGCTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017833.3-1699s21c1
Sequence:CCGGGAATTGTGCCATTGTACTTATCTCGAGATAAGTACAATGGCACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017833.3-1205s21c1
Sequence:CCGGCCAACCAGAATGGATCCTTAACTCGAGTTAAGGATCCATTCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017833.2-878s1c1
Sequence:CCGGCCAACTCAACGAGAGAAGCATCTCGAGATGCTTCTCTCGTTGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017833.2-929s1c1
Sequence:CCGGGAACAAGTGATGGAATATCAACTCGAGTTGATATTCCATCACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162104    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017833.2-1635s1c1
Sequence:CCGGCCACTGACACTTTACATGGAACTCGAGTTCCATGTAAAGTGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017833.2-484s1c1
Sequence:CCGGCCTGATAAAGGCTACAGTGATCTCGAGATCACTGTAGCCTTTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017833.2-630s1c1
Sequence:CCGGCAGATGAAGTCAGGGAATCTTCTCGAGAAGATTCCCTGACTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017833.2-1156s1c1
Sequence:CCGGGACTCACAACCTGAACCGAATCTCGAGATTCGGTTCAGGTTGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017833
DNAJC28 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 28
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017833.3-663s21c1
Sequence:CCGGCATAAGCTTGCCAAGCAATATCTCGAGATATTGCTTGGCAAGCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017833.3-1038s21c1
Sequence:CCGGACGCAAGCTATAGAACGTTTACTCGAGTAAACGTTCTATAGCTTGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017833.3-1699s21c1
Sequence:CCGGGAATTGTGCCATTGTACTTATCTCGAGATAAGTACAATGGCACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017833.3-1205s21c1
Sequence:CCGGCCAACCAGAATGGATCCTTAACTCGAGTTAAGGATCCATTCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017833.2-878s1c1
Sequence:CCGGCCAACTCAACGAGAGAAGCATCTCGAGATGCTTCTCTCGTTGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017833.2-929s1c1
Sequence:CCGGGAACAAGTGATGGAATATCAACTCGAGTTGATATTCCATCACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162104    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017833.2-1635s1c1
Sequence:CCGGCCACTGACACTTTACATGGAACTCGAGTTCCATGTAAAGTGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017833.2-484s1c1
Sequence:CCGGCCTGATAAAGGCTACAGTGATCTCGAGATCACTGTAGCCTTTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017833.2-630s1c1
Sequence:CCGGCAGATGAAGTCAGGGAATCTTCTCGAGAAGATTCCCTGACTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017833.2-1156s1c1
Sequence:CCGGGACTCACAACCTGAACCGAATCTCGAGATTCGGTTCAGGTTGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138664
DNAJC28 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 28
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138664.1-1288s1c1
Sequence:CCGGGCCTTCGTAGAAGCAAACGAACTCGAGTTCGTTTGCTTCTACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138664.1-1373s1c1
Sequence:CCGGCAGGCTTTCTAAACTGGCTAACTCGAGTTAGCCAGTTTAGAAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138664.1-1562s1c1
Sequence:CCGGCCGGTGGTAGATGAGAAACTTCTCGAGAAGTTTCTCATCTACCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138664.1-657s1c1
Sequence:CCGGGCACCGACATTACTTAAGCTTCTCGAGAAGCTTAAGTAATGTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138664.1-1374s1c1
Sequence:CCGGAGGCTTTCTAAACTGGCTAAACTCGAGTTTAGCCAGTTTAGAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138664
DNAJC28 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 28
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138664.1-1288s1c1
Sequence:CCGGGCCTTCGTAGAAGCAAACGAACTCGAGTTCGTTTGCTTCTACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138664.1-1373s1c1
Sequence:CCGGCAGGCTTTCTAAACTGGCTAACTCGAGTTAGCCAGTTTAGAAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138664.1-1562s1c1
Sequence:CCGGCCGGTGGTAGATGAGAAACTTCTCGAGAAGTTTCTCATCTACCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138664.1-657s1c1
Sequence:CCGGGCACCGACATTACTTAAGCTTCTCGAGAAGCTTAAGTAATGTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138664.1-1374s1c1
Sequence:CCGGAGGCTTTCTAAACTGGCTAAACTCGAGTTTAGCCAGTTTAGAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138664
DNAJC28 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 28
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138664.1-1288s1c1
Sequence:CCGGGCCTTCGTAGAAGCAAACGAACTCGAGTTCGTTTGCTTCTACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138664.1-1373s1c1
Sequence:CCGGCAGGCTTTCTAAACTGGCTAACTCGAGTTAGCCAGTTTAGAAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138664.1-1562s1c1
Sequence:CCGGCCGGTGGTAGATGAGAAACTTCTCGAGAAGTTTCTCATCTACCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138664.1-657s1c1
Sequence:CCGGGCACCGACATTACTTAAGCTTCTCGAGAAGCTTAAGTAATGTCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138664.1-1374s1c1
Sequence:CCGGAGGCTTTCTAAACTGGCTAAACTCGAGTTTAGCCAGTTTAGAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks