EMAIL THIS PAGE TO A FRIEND

DNAJC2

DnaJ (Hsp40) homolog, subfamily C, member 2

65 Gene Product Result for
Synonyms: MPHOSPH11 MPP11 ZRF1 ZUO1
UniProtKB ID: Q99543, A4VCI0, Q9BVX1
Gene ID:
Human(27000) Summary: This gene is a member of the M-phase phosphoprotein (MPP) family. The gene encodes a phosphoprotein with a J domain and a Myb DNA-binding domain which localizes to both the nucleus and the cytosol. The protein is capable of forming a heterodimeric complex that associates with ribosomes, acting as a molecular chaperone for nascent polypeptide chains as they exit the ribosome. This protein was identified as a leukemia-associated antigen and expression of the gene is upregulated in leukemic blasts. Also, chromosomal aberrations involving this gene are associated with primary head and neck squamous cell tumors. This gene has a pseudogene on chromosome 6. Alternatively spliced variants which encode different protein isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(22791) DnaJ (Hsp40) homolog, subfamily C, member 2
Rat(116456) DnaJ (Hsp40) homolog, subfamily C, member 2
Zebrafish(403080) DnaJ (Hsp40) homolog, subfamily C, member 2
cow(507897) DnaJ (Hsp40) homolog, subfamily C, member 2
domestic cat(101086464) DnaJ (Hsp40) homolog, subfamily C, member 2
dog(483275) DnaJ (Hsp40) homolog, subfamily C, member 2
chicken(417717) DnaJ (Hsp40) homolog, subfamily C, member 2
sheep(101119299) DnaJ (Hsp40) homolog, subfamily C, member 2
Domestic Rabbit(100341166) DnaJ (Hsp40) homolog, subfamily C, member 2
naked mole-rat(101722375) DnaJ (Hsp40) homolog, subfamily C, member 2
domestic guinea pig(100723921) DnaJ (Hsp40) homolog, subfamily C, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001129887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001129887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001129887 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014377 Rosetta Predictions human pricing
NM_053776 Rosetta Predictions rat pricing
NM_009584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151582 predicted 1437
2 SASI_Hs01_00151583 predicted 1614
3 SASI_Hs01_00151584 predicted 1414
4 SASI_Hs01_00151585 predicted 1612
5 SASI_Hs01_00151586 predicted 311
6 SASI_Hs02_00345536 predicted 1753
7 SASI_Hs01_00151588 predicted 1606
8 SASI_Hs01_00151589 predicted 1680
9 SASI_Hs01_00151590 predicted 1873
10 SASI_Hs01_00151591 predicted 504
11 SASI_Hs01_00151587 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266577 predicted 1507
2 SASI_Rn02_00266578 predicted 1569
3 SASI_Rn01_00058989 predicted 264
4 SASI_Rn02_00266579 predicted 1497
5 SASI_Rn01_00058992 predicted 697
6 SASI_Rn02_00266580 predicted 1502
7 SASI_Rn01_00058993 predicted 227
8 SASI_Rn01_00058995 predicted 569
9 SASI_Rn02_00266581 predicted 1780
10 SASI_Rn01_00058997 predicted 380
11 SASI_Rn01_00058990 predicted 217
12 SASI_Rn01_00058991 predicted 370
13 SASI_Rn01_00058994 predicted 611
14 SASI_Rn01_00058996 predicted 317
15 SASI_Rn01_00058998 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147992 predicted 1542
2 SASI_Mm02_00316486 predicted 1735
3 SASI_Mm02_00316487 predicted 1769
4 SASI_Mm01_00147997 predicted 1261
5 SASI_Mm02_00316488 predicted 1569
6 SASI_Mm02_00316489 predicted 238
7 SASI_Mm02_00316490 predicted 1307
8 SASI_Mm02_00316491 predicted 1530
9 SASI_Mm02_00316492 predicted 1419
10 SASI_Mm02_00316493 predicted 1216
11 SASI_Mm01_00147990 predicted 1484
12 SASI_Mm01_00147991 predicted 1606
13 SASI_Mm01_00147993 predicted 1302
14 SASI_Mm01_00147994 predicted 365
15 SASI_Mm01_00147995 predicted 429
16 SASI_Mm01_00147996 predicted 437
17 SASI_Mm01_00147998 predicted 246
18 SASI_Mm01_00147999 predicted 211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009584
VALIDATED
DNAJC2 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-428s21c1
Sequence:CCGGACAGATCAAAGCAGCTCATAACTCGAGTTATGAGCTGCTTTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-1541s21c1
Sequence:CCGGATGGGAAGTCATTGCTAATTACTCGAGTAATTAGCAATGACTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-1478s21c1
Sequence:CCGGAGAAGATGATCTGCAATTATTCTCGAGAATAATTGCAGATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-1217s21c1
Sequence:CCGGCAATGAGGCAGACCGTGTTAACTCGAGTTAACACGGTCTGCCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-522s21c1
Sequence:CCGGTACTTCACTTGCATAACTAAACTCGAGTTTAGTTATGCAAGTGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-1594s21c1
Sequence:CCGGGAACTGCCAAAGATGTTATTACTCGAGTAATAACATCTTTGGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009584
VALIDATED
DNAJC2 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-428s21c1
Sequence:CCGGACAGATCAAAGCAGCTCATAACTCGAGTTATGAGCTGCTTTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-1541s21c1
Sequence:CCGGATGGGAAGTCATTGCTAATTACTCGAGTAATTAGCAATGACTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-1478s21c1
Sequence:CCGGAGAAGATGATCTGCAATTATTCTCGAGAATAATTGCAGATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-1217s21c1
Sequence:CCGGCAATGAGGCAGACCGTGTTAACTCGAGTTAACACGGTCTGCCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-522s21c1
Sequence:CCGGTACTTCACTTGCATAACTAAACTCGAGTTTAGTTATGCAAGTGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-1594s21c1
Sequence:CCGGGAACTGCCAAAGATGTTATTACTCGAGTAATAACATCTTTGGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009584
VALIDATED
DNAJC2 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-428s21c1
Sequence:CCGGACAGATCAAAGCAGCTCATAACTCGAGTTATGAGCTGCTTTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-1541s21c1
Sequence:CCGGATGGGAAGTCATTGCTAATTACTCGAGTAATTAGCAATGACTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-1478s21c1
Sequence:CCGGAGAAGATGATCTGCAATTATTCTCGAGAATAATTGCAGATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-1217s21c1
Sequence:CCGGCAATGAGGCAGACCGTGTTAACTCGAGTTAACACGGTCTGCCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-522s21c1
Sequence:CCGGTACTTCACTTGCATAACTAAACTCGAGTTTAGTTATGCAAGTGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009584.4-1594s21c1
Sequence:CCGGGAACTGCCAAAGATGTTATTACTCGAGTAATAACATCTTTGGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001129887
VALIDATED
DNAJC2 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129887.1-1718s21c1
Sequence:CCGGACGATTTGAAGGTCCATATACCTCGAGGTATATGGACCTTCAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001129887.1-500s21c1
Sequence:CCGGCTGGAAGAACCAAGATCATTACTCGAGTAATGATCTTGGTTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001129887.1-623s21c1
Sequence:CCGGAGCAGCTGGTGAACCAATAAACTCGAGTTTATTGGTTCACCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001129887.1-660s21c1
Sequence:CCGGTACTTCACTTGCATAACTAAACTCGAGTTTAGTTATGCAAGTGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001129887.1-566s21c1
Sequence:CCGGACAGATCAAAGCAGCTCATAACTCGAGTTATGAGCTGCTTTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001129887
VALIDATED
DNAJC2 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129887.1-1718s21c1
Sequence:CCGGACGATTTGAAGGTCCATATACCTCGAGGTATATGGACCTTCAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001129887.1-500s21c1
Sequence:CCGGCTGGAAGAACCAAGATCATTACTCGAGTAATGATCTTGGTTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001129887.1-623s21c1
Sequence:CCGGAGCAGCTGGTGAACCAATAAACTCGAGTTTATTGGTTCACCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001129887.1-660s21c1
Sequence:CCGGTACTTCACTTGCATAACTAAACTCGAGTTTAGTTATGCAAGTGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001129887.1-566s21c1
Sequence:CCGGACAGATCAAAGCAGCTCATAACTCGAGTTATGAGCTGCTTTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001129887
VALIDATED
DNAJC2 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129887.1-1718s21c1
Sequence:CCGGACGATTTGAAGGTCCATATACCTCGAGGTATATGGACCTTCAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001129887.1-500s21c1
Sequence:CCGGCTGGAAGAACCAAGATCATTACTCGAGTAATGATCTTGGTTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001129887.1-623s21c1
Sequence:CCGGAGCAGCTGGTGAACCAATAAACTCGAGTTTATTGGTTCACCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001129887.1-660s21c1
Sequence:CCGGTACTTCACTTGCATAACTAAACTCGAGTTTAGTTATGCAAGTGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001129887.1-566s21c1
Sequence:CCGGACAGATCAAAGCAGCTCATAACTCGAGTTATGAGCTGCTTTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009583
DNAJC2 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009583.1-1249s1c1
Sequence:CCGGGCTTGAATGAAATCCTGGCTTCTCGAGAAGCCAGGATTTCATTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009583.1-309s1c1
Sequence:CCGGCCCAAAGATTGGAAGAATCAACTCGAGTTGATTCTTCCAATCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009583.1-531s1c1
Sequence:CCGGCGGGCATTTAACAGTGTAGATCTCGAGATCTACACTGTTAAATGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009583.1-1730s1c1
Sequence:CCGGCAACAGAAGAACAGAAACTTTCTCGAGAAAGTTTCTGTTCTTCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009583.1-405s1c1
Sequence:CCGGGCAATGGTCTTGAAACATCATCTCGAGATGATGTTTCAAGACCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009583
DNAJC2 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009583.1-1249s1c1
Sequence:CCGGGCTTGAATGAAATCCTGGCTTCTCGAGAAGCCAGGATTTCATTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009583.1-309s1c1
Sequence:CCGGCCCAAAGATTGGAAGAATCAACTCGAGTTGATTCTTCCAATCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009583.1-531s1c1
Sequence:CCGGCGGGCATTTAACAGTGTAGATCTCGAGATCTACACTGTTAAATGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009583.1-1730s1c1
Sequence:CCGGCAACAGAAGAACAGAAACTTTCTCGAGAAAGTTTCTGTTCTTCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009583.1-405s1c1
Sequence:CCGGGCAATGGTCTTGAAACATCATCTCGAGATGATGTTTCAAGACCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009583
DNAJC2 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009583.1-1249s1c1
Sequence:CCGGGCTTGAATGAAATCCTGGCTTCTCGAGAAGCCAGGATTTCATTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009583.1-309s1c1
Sequence:CCGGCCCAAAGATTGGAAGAATCAACTCGAGTTGATTCTTCCAATCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009583.1-531s1c1
Sequence:CCGGCGGGCATTTAACAGTGTAGATCTCGAGATCTACACTGTTAAATGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009583.1-1730s1c1
Sequence:CCGGCAACAGAAGAACAGAAACTTTCTCGAGAAAGTTTCTGTTCTTCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009583.1-405s1c1
Sequence:CCGGGCAATGGTCTTGAAACATCATCTCGAGATGATGTTTCAAGACCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks