EMAIL THIS PAGE TO A FRIEND

DNAJC30

DnaJ (Hsp40) homolog, subfamily C, member 30

77 Gene Product Result for
Synonyms: WBSCR18
UniProtKB ID: Q96LL9, Q9BSG8
Gene ID:
Human(84277) Summary: This intronless gene encodes a member of the DNAJ molecular chaperone homology domain-containing protein family. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. [provided by RefSeq, Jul 2008]
Mouse(66114) DnaJ (Hsp40) homolog, subfamily C, member 30
Rat(368190) DnaJ (Hsp40) homolog, subfamily C, member 30
chicken(770202) DnaJ (Hsp40) homolog, subfamily C, member 30
domestic cat(101096865) DnaJ (Hsp40) homolog, subfamily C, member 30
cow(617118) DnaJ (Hsp40) homolog, subfamily C, member 30
dog(489805) DnaJ (Hsp40) homolog, subfamily C, member 30
sheep(101113193) DnaJ (Hsp40) homolog, subfamily C, member 30
domestic guinea pig(100727394) DnaJ (Hsp40) homolog, subfamily C, member 30
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032317 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025362 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025362 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025362 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU180261 MISSION® esiRNA esiRNA targeting mouse Dnajc30 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032317 Rosetta Predictions human pricing
NM_001109024 Rosetta Predictions rat pricing
NM_025362 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108711 predicted 1135
2 SASI_Hs01_00108712 predicted 599
3 SASI_Hs01_00108713 predicted 898
4 SASI_Hs01_00108714 predicted 1126
5 SASI_Hs01_00108715 predicted 1090
6 SASI_Hs01_00108716 predicted 1032
7 SASI_Hs01_00108717 predicted 1126
8 SASI_Hs01_00108718 predicted 210
9 SASI_Hs01_00108719 predicted 854
10 SASI_Hs01_00108720 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109024 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244424 predicted 635
2 SASI_Rn02_00244425 predicted 714
3 SASI_Rn02_00244426 predicted 264
4 SASI_Rn02_00244427 predicted 490
5 SASI_Rn02_00244428 predicted 646
6 SASI_Rn02_00244429 predicted 711
7 SASI_Rn02_00244430 predicted 311
8 SASI_Rn02_00244431 predicted 204
9 SASI_Rn02_00244432 predicted 304
10 SASI_Rn02_00244433 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154797 predicted 772
2 SASI_Mm01_00154804 predicted 201
3 SASI_Mm01_00154805 predicted 220
4 SASI_Mm01_00154798 predicted 761
5 SASI_Mm01_00154806 predicted 673
6 SASI_Mm02_00328060 predicted 684
7 SASI_Mm01_00154799 predicted 334
8 SASI_Mm02_00328061 predicted 329
9 SASI_Mm01_00154800 predicted 916
10 SASI_Mm02_00328062 predicted 340
11 SASI_Mm01_00154801 predicted 337
12 SASI_Mm01_00154802 predicted 291
13 SASI_Mm01_00154803 predicted 916
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032317
DNAJC30 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 30
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032317.2-508s1c1
Sequence:CCGGGATGTTCAACTTTGACGCCTTCTCGAGAAGGCGTCAAAGTTGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032317.2-1800s1c1
Sequence:CCGGCCACAGGGATTACAGCATAATCTCGAGATTATGCTGTAATCCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032317.2-2374s1c1
Sequence:CCGGCCAGGAGTGGTTTGGTATATTCTCGAGAATATACCAAACCACTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032317.2-678s1c1
Sequence:CCGGCAATCTTCATCATCATCGGCTCTCGAGAGCCGATGATGATGAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183209    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032317.2-2150s1c1
Sequence:CCGGGCTCTGTTTCTAATTCATGTTCTCGAGAACATGAATTAGAAACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032317.2-123s21c1
Sequence:CCGGGCCTAGGAGCGAGGACTTATTCTCGAGAATAAGTCCTCGCTCCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032317.2-501s21c1
Sequence:CCGGACCGCACGATGTTCAACTTTGCTCGAGCAAAGTTGAACATCGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032317.2-2348s21c1
Sequence:CCGGGGCCCAAGTCTAGGGTCTAAACTCGAGTTTAGACCCTAGACTTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032317.2-594s21c1
Sequence:CCGGTTCGCAAACGGCAGGAGTATCCTCGAGGATACTCCTGCCGTTTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032317.2-341s21c1
Sequence:CCGGACCCTCCGTCGCAAGTATGATCTCGAGATCATACTTGCGACGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032317
DNAJC30 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 30
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032317.2-508s1c1
Sequence:CCGGGATGTTCAACTTTGACGCCTTCTCGAGAAGGCGTCAAAGTTGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032317.2-1800s1c1
Sequence:CCGGCCACAGGGATTACAGCATAATCTCGAGATTATGCTGTAATCCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032317.2-2374s1c1
Sequence:CCGGCCAGGAGTGGTTTGGTATATTCTCGAGAATATACCAAACCACTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032317.2-678s1c1
Sequence:CCGGCAATCTTCATCATCATCGGCTCTCGAGAGCCGATGATGATGAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183209    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032317.2-2150s1c1
Sequence:CCGGGCTCTGTTTCTAATTCATGTTCTCGAGAACATGAATTAGAAACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032317.2-123s21c1
Sequence:CCGGGCCTAGGAGCGAGGACTTATTCTCGAGAATAAGTCCTCGCTCCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032317.2-501s21c1
Sequence:CCGGACCGCACGATGTTCAACTTTGCTCGAGCAAAGTTGAACATCGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032317.2-2348s21c1
Sequence:CCGGGGCCCAAGTCTAGGGTCTAAACTCGAGTTTAGACCCTAGACTTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032317.2-594s21c1
Sequence:CCGGTTCGCAAACGGCAGGAGTATCCTCGAGGATACTCCTGCCGTTTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032317.2-341s21c1
Sequence:CCGGACCCTCCGTCGCAAGTATGATCTCGAGATCATACTTGCGACGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032317
DNAJC30 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 30
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032317.2-508s1c1
Sequence:CCGGGATGTTCAACTTTGACGCCTTCTCGAGAAGGCGTCAAAGTTGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032317.2-1800s1c1
Sequence:CCGGCCACAGGGATTACAGCATAATCTCGAGATTATGCTGTAATCCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032317.2-2374s1c1
Sequence:CCGGCCAGGAGTGGTTTGGTATATTCTCGAGAATATACCAAACCACTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032317.2-678s1c1
Sequence:CCGGCAATCTTCATCATCATCGGCTCTCGAGAGCCGATGATGATGAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183209    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032317.2-2150s1c1
Sequence:CCGGGCTCTGTTTCTAATTCATGTTCTCGAGAACATGAATTAGAAACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032317.2-123s21c1
Sequence:CCGGGCCTAGGAGCGAGGACTTATTCTCGAGAATAAGTCCTCGCTCCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032317.2-501s21c1
Sequence:CCGGACCGCACGATGTTCAACTTTGCTCGAGCAAAGTTGAACATCGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032317.2-2348s21c1
Sequence:CCGGGGCCCAAGTCTAGGGTCTAAACTCGAGTTTAGACCCTAGACTTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032317.2-594s21c1
Sequence:CCGGTTCGCAAACGGCAGGAGTATCCTCGAGGATACTCCTGCCGTTTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032317.2-341s21c1
Sequence:CCGGACCCTCCGTCGCAAGTATGATCTCGAGATCATACTTGCGACGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025362
VALIDATED
DNAJC30 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 30
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025362.2-908s1c1
Sequence:CCGGCCGGATAAAGATTCCTGTGAACTCGAGTTCACAGGAATCTTTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025362.2-653s1c1
Sequence:CCGGCCACTTTCTTTGTCGTCCTTTCTCGAGAAAGGACGACAAAGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025362.2-238s1c1
Sequence:CCGGCGGCAGAGCTTCCTCTACCATCTCGAGATGGTAGAGGAAGCTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025362.2-348s1c1
Sequence:CCGGGCGCAAGTATGACCGAGGTTTCTCGAGAAACCTCGGTCATACTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025362.2-684s1c1
Sequence:CCGGCGTCTTTGTTGGCTTTCGTATCTCGAGATACGAAAGCCAACAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025362.3-550s21c1
Sequence:CCGGCTAGAGAGAGAACGGCGTTTGCTCGAGCAAACGCCGTTCTCTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025362.3-681s21c1
Sequence:CCGGCGTCTTTGTTGGCTTTCGTATCTCGAGATACGAAAGCCAACAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025362.3-203s21c1
Sequence:CCGGCCACGCAAGCACAGATCAAAGCTCGAGCTTTGATCTGTGCTTGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025362.3-905s21c1
Sequence:CCGGCCGGATAAAGATTCCTGTGAACTCGAGTTCACAGGAATCTTTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025362.3-496s21c1
Sequence:CCGGGGTCGCACCATGTTCGACTTTCTCGAGAAAGTCGAACATGGTGCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025362
VALIDATED
DNAJC30 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 30
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025362.2-908s1c1
Sequence:CCGGCCGGATAAAGATTCCTGTGAACTCGAGTTCACAGGAATCTTTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025362.2-653s1c1
Sequence:CCGGCCACTTTCTTTGTCGTCCTTTCTCGAGAAAGGACGACAAAGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025362.2-238s1c1
Sequence:CCGGCGGCAGAGCTTCCTCTACCATCTCGAGATGGTAGAGGAAGCTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025362.2-348s1c1
Sequence:CCGGGCGCAAGTATGACCGAGGTTTCTCGAGAAACCTCGGTCATACTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025362.2-684s1c1
Sequence:CCGGCGTCTTTGTTGGCTTTCGTATCTCGAGATACGAAAGCCAACAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025362.3-550s21c1
Sequence:CCGGCTAGAGAGAGAACGGCGTTTGCTCGAGCAAACGCCGTTCTCTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025362.3-681s21c1
Sequence:CCGGCGTCTTTGTTGGCTTTCGTATCTCGAGATACGAAAGCCAACAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025362.3-203s21c1
Sequence:CCGGCCACGCAAGCACAGATCAAAGCTCGAGCTTTGATCTGTGCTTGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025362.3-905s21c1
Sequence:CCGGCCGGATAAAGATTCCTGTGAACTCGAGTTCACAGGAATCTTTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025362.3-496s21c1
Sequence:CCGGGGTCGCACCATGTTCGACTTTCTCGAGAAAGTCGAACATGGTGCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025362
VALIDATED
DNAJC30 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 30
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025362.2-908s1c1
Sequence:CCGGCCGGATAAAGATTCCTGTGAACTCGAGTTCACAGGAATCTTTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025362.2-653s1c1
Sequence:CCGGCCACTTTCTTTGTCGTCCTTTCTCGAGAAAGGACGACAAAGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025362.2-238s1c1
Sequence:CCGGCGGCAGAGCTTCCTCTACCATCTCGAGATGGTAGAGGAAGCTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025362.2-348s1c1
Sequence:CCGGGCGCAAGTATGACCGAGGTTTCTCGAGAAACCTCGGTCATACTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025362.2-684s1c1
Sequence:CCGGCGTCTTTGTTGGCTTTCGTATCTCGAGATACGAAAGCCAACAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025362.3-550s21c1
Sequence:CCGGCTAGAGAGAGAACGGCGTTTGCTCGAGCAAACGCCGTTCTCTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025362.3-681s21c1
Sequence:CCGGCGTCTTTGTTGGCTTTCGTATCTCGAGATACGAAAGCCAACAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025362.3-203s21c1
Sequence:CCGGCCACGCAAGCACAGATCAAAGCTCGAGCTTTGATCTGTGCTTGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025362.3-905s21c1
Sequence:CCGGCCGGATAAAGATTCCTGTGAACTCGAGTTCACAGGAATCTTTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025362.3-496s21c1
Sequence:CCGGGGTCGCACCATGTTCGACTTTCTCGAGAAAGTCGAACATGGTGCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks