EMAIL THIS PAGE TO A FRIEND

DNAJC3

DnaJ (Hsp40) homolog, subfamily C, member 3

50 Gene Product Result for
Synonyms: ERdj6 HP58 P58 P58IPK PRKRI
UniProtKB ID: Q13217, Q86WT9, Q8N4N2
Gene ID:
Human(5611) Summary: This gene encodes a protein with multiple tetratricopeptide repeat (TPR) motifs as well as the highly conserved J domain found in DNAJ chaperone family members. It is a member of the tetratricopeptide repeat family of proteins and acts as an inhibitor of the interferon-induced, dsRNA-activated protein kinase (PKR). [provided by RefSeq, Jul 2010]
Mouse(100037258) DnaJ (Hsp40) homolog, subfamily C, member 3
Rat(63880) DnaJ (Hsp40) homolog, subfamily C, member 3
domestic guinea pig(100726056) DnaJ (Hsp40) homolog, subfamily C, member 3
naked mole-rat(101710818) DnaJ (Hsp40) homolog, subfamily C, member 3
sheep(101110685) DnaJ (Hsp40) homolog, subfamily C, member 3
Zebrafish(322544) DnaJ (Hsp40) homolog, subfamily C, member 3
chicken(418787) DnaJ (Hsp40) homolog, subfamily C, member 3
cow(286770) DnaJ (Hsp40) homolog, subfamily C, member 3
Horse(100059810) DnaJ (Hsp40) homolog, subfamily C, member 3
domestic cat(101099171) DnaJ (Hsp40) homolog, subfamily C, member 3
dog(476966) DnaJ (Hsp40) homolog, subfamily C, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008929 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008929 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008929 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006260 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU145981 MISSION® esiRNA esiRNA targeting mouse Dnajc3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006260 Rosetta Predictions human pricing
NM_022232 Rosetta Predictions rat pricing
NM_008929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242678 predicted 418
2 SASI_Hs01_00242679 predicted 482
3 SASI_Hs01_00242680 predicted 755
4 SASI_Hs01_00242681 predicted 762
5 SASI_Hs01_00242682 predicted 542
6 SASI_Hs01_00242683 predicted 357
7 SASI_Hs02_00341207 predicted 1039
8 SASI_Hs01_00242685 predicted 1000
9 SASI_Hs01_00242686 predicted 635
10 SASI_Hs01_00242687 predicted 327
11 SASI_Hs01_00242684 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031203 predicted 511
2 SASI_Rn01_00031204 predicted 296
3 SASI_Rn01_00031205 predicted 778
4 SASI_Rn01_00031206 predicted 892
5 SASI_Rn01_00031207 predicted 327
6 SASI_Rn01_00031208 predicted 1121
7 SASI_Rn02_00263000 predicted 389
8 SASI_Rn01_00031209 predicted 727
9 SASI_Rn01_00031210 predicted 370
10 SASI_Rn01_00031211 predicted 495
11 SASI_Rn01_00031212 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314962 predicted 604
2 SASI_Mm02_00314963 predicted 720
3 SASI_Mm02_00314964 predicted 588
4 SASI_Mm02_00314965 predicted 874
5 SASI_Mm02_00314966 predicted 742
6 SASI_Mm02_00314967 predicted 681
7 SASI_Mm02_00314968 predicted 996
8 SASI_Mm02_00314969 predicted 831
9 SASI_Mm02_00314970 predicted 401
10 SASI_Mm02_00314971 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008929
VALIDATED
DNAJC3 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008929.2-1756s1c1
Sequence:CCGGGCTGAGCTTATTGTAGACTTACTCGAGTAAGTCTACAATAAGCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008929.2-306s1c1
Sequence:CCGGCGATAACTATATCGCATACTACTCGAGTAGTATGCGATATAGTTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008929.2-681s1c1
Sequence:CCGGGCGAGCAGAATGCTTCATAAACTCGAGTTTATGAAGCATTCTGCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008929.2-1369s1c1
Sequence:CCGGCCAGATAATTTCCAGAATGAACTCGAGTTCATTCTGGAAATTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008929.2-1584s1c1
Sequence:CCGGCGGACCGTTCAGATTTAAGTTCTCGAGAACTTAAATCTGAACGGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008929
VALIDATED
DNAJC3 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008929.2-1756s1c1
Sequence:CCGGGCTGAGCTTATTGTAGACTTACTCGAGTAAGTCTACAATAAGCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008929.2-306s1c1
Sequence:CCGGCGATAACTATATCGCATACTACTCGAGTAGTATGCGATATAGTTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008929.2-681s1c1
Sequence:CCGGGCGAGCAGAATGCTTCATAAACTCGAGTTTATGAAGCATTCTGCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008929.2-1369s1c1
Sequence:CCGGCCAGATAATTTCCAGAATGAACTCGAGTTCATTCTGGAAATTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008929.2-1584s1c1
Sequence:CCGGCGGACCGTTCAGATTTAAGTTCTCGAGAACTTAAATCTGAACGGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008929
VALIDATED
DNAJC3 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008929.2-1756s1c1
Sequence:CCGGGCTGAGCTTATTGTAGACTTACTCGAGTAAGTCTACAATAAGCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008929.2-306s1c1
Sequence:CCGGCGATAACTATATCGCATACTACTCGAGTAGTATGCGATATAGTTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008929.2-681s1c1
Sequence:CCGGGCGAGCAGAATGCTTCATAAACTCGAGTTTATGAAGCATTCTGCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008929.2-1369s1c1
Sequence:CCGGCCAGATAATTTCCAGAATGAACTCGAGTTCATTCTGGAAATTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008929.2-1584s1c1
Sequence:CCGGCGGACCGTTCAGATTTAAGTTCTCGAGAACTTAAATCTGAACGGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006260
VALIDATED
DNAJC3 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006260.2-145s1c1
Sequence:CCGGCATCTTGAATTGGGCAAGAAACTCGAGTTTCTTGCCCAATTCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006260.2-527s1c1
Sequence:CCGGGTGGAGATTATACTGCTGCTACTCGAGTAGCAGCAGTATAATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006260.2-1360s1c1
Sequence:CCGGGCTAAAGAAGTCCTCTCTGATCTCGAGATCAGAGAGGACTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006260.2-1192s1c1
Sequence:CCGGCAGTCGCAGAAACGAGATTATCTCGAGATAATCTCGTTTCTGCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006260.2-890s1c1
Sequence:CCGGCCAGCAAATATGAATCTGTCACTCGAGTGACAGATTCATATTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006260.2-1294s1c1
Sequence:CCGGCCAGATAACTTCCAGAATGAACTCGAGTTCATTCTGGAAGTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006260.2-1291s1c1
Sequence:CCGGCACCCAGATAACTTCCAGAATCTCGAGATTCTGGAAGTTATCTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006260.2-919s1c1
Sequence:CCGGGAGCCAAGCATTGCTGAATATCTCGAGATATTCAGCAATGCTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006260.2-664s1c1
Sequence:CCGGGCTGCGTCAAAGTTGAAGAATCTCGAGATTCTTCAACTTTGACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006260.2-943s1c1
Sequence:CCGGGTTCGTTCAAAGGAGAGGATTCTCGAGAATCCTCTCCTTTGAACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006260
VALIDATED
DNAJC3 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006260.2-145s1c1
Sequence:CCGGCATCTTGAATTGGGCAAGAAACTCGAGTTTCTTGCCCAATTCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006260.2-527s1c1
Sequence:CCGGGTGGAGATTATACTGCTGCTACTCGAGTAGCAGCAGTATAATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006260.2-1360s1c1
Sequence:CCGGGCTAAAGAAGTCCTCTCTGATCTCGAGATCAGAGAGGACTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006260.2-1192s1c1
Sequence:CCGGCAGTCGCAGAAACGAGATTATCTCGAGATAATCTCGTTTCTGCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006260.2-890s1c1
Sequence:CCGGCCAGCAAATATGAATCTGTCACTCGAGTGACAGATTCATATTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006260.2-1294s1c1
Sequence:CCGGCCAGATAACTTCCAGAATGAACTCGAGTTCATTCTGGAAGTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006260.2-1291s1c1
Sequence:CCGGCACCCAGATAACTTCCAGAATCTCGAGATTCTGGAAGTTATCTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006260.2-919s1c1
Sequence:CCGGGAGCCAAGCATTGCTGAATATCTCGAGATATTCAGCAATGCTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006260.2-664s1c1
Sequence:CCGGGCTGCGTCAAAGTTGAAGAATCTCGAGATTCTTCAACTTTGACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006260.2-943s1c1
Sequence:CCGGGTTCGTTCAAAGGAGAGGATTCTCGAGAATCCTCTCCTTTGAACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006260
VALIDATED
DNAJC3 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006260.2-145s1c1
Sequence:CCGGCATCTTGAATTGGGCAAGAAACTCGAGTTTCTTGCCCAATTCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006260.2-527s1c1
Sequence:CCGGGTGGAGATTATACTGCTGCTACTCGAGTAGCAGCAGTATAATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006260.2-1360s1c1
Sequence:CCGGGCTAAAGAAGTCCTCTCTGATCTCGAGATCAGAGAGGACTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006260.2-1192s1c1
Sequence:CCGGCAGTCGCAGAAACGAGATTATCTCGAGATAATCTCGTTTCTGCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006260.2-890s1c1
Sequence:CCGGCCAGCAAATATGAATCTGTCACTCGAGTGACAGATTCATATTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006260.2-1294s1c1
Sequence:CCGGCCAGATAACTTCCAGAATGAACTCGAGTTCATTCTGGAAGTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006260.2-1291s1c1
Sequence:CCGGCACCCAGATAACTTCCAGAATCTCGAGATTCTGGAAGTTATCTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_006260.2-919s1c1
Sequence:CCGGGAGCCAAGCATTGCTGAATATCTCGAGATATTCAGCAATGCTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006260.2-664s1c1
Sequence:CCGGGCTGCGTCAAAGTTGAAGAATCTCGAGATTCTTCAACTTTGACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006260.2-943s1c1
Sequence:CCGGGTTCGTTCAAAGGAGAGGATTCTCGAGAATCCTCTCCTTTGAACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks