EMAIL THIS PAGE TO A FRIEND

DNAJC4

DnaJ (Hsp40) homolog, subfamily C, member 4

56 Gene Product Result for
Synonyms: DANJC4 HSPF2 MCG18
UniProtKB ID: Q9NNZ3, O14716
Gene ID:
Mouse(57431) DnaJ (Hsp40) homolog, subfamily C, member 4
Rat(361717) DnaJ (Hsp40) homolog, subfamily C, member 4
domestic guinea pig(100733593) DnaJ (Hsp40) homolog, subfamily C, member 4
naked mole-rat(101717203) DnaJ (Hsp40) homolog, subfamily C, member 4
sheep(101115588) DnaJ (Hsp40) homolog, subfamily C, member 4
Zebrafish(324373) DnaJ (Hsp40) homolog, subfamily C, member 4
cow(533579) DnaJ (Hsp40) homolog, subfamily C, member 4
domestic cat(101092213) DnaJ (Hsp40) homolog, subfamily C, member 4
Horse(100055190) DnaJ (Hsp40) homolog, subfamily C, member 4
dog(612133) DnaJ (Hsp40) homolog, subfamily C, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005528 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005528 Rosetta Predictions human pricing
NM_001013196 Rosetta Predictions rat pricing
NM_020566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339749 predicted 952
2 SASI_Hs01_00238887 predicted 716
3 SASI_Hs02_00339750 predicted 958
4 SASI_Hs02_00339751 predicted 921
5 SASI_Hs02_00339752 predicted 468
6 SASI_Hs02_00339753 predicted 522
7 SASI_Hs01_00238891 predicted 708
8 SASI_Hs02_00339754 predicted 708
9 SASI_Hs02_00339755 predicted 486
10 SASI_Hs01_00238895 predicted 711
11 SASI_Hs01_00238886 predicted 901
12 SASI_Hs01_00238888 predicted 855
13 SASI_Hs01_00238889 predicted 915
14 SASI_Hs01_00238890 predicted 1026
15 SASI_Hs01_00238892 predicted 931
16 SASI_Hs01_00238893 predicted 931
17 SASI_Hs01_00238894 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038827 predicted 290
2 SASI_Rn01_00038828 predicted 224
3 SASI_Rn01_00038829 predicted 386
4 SASI_Rn01_00038830 predicted 401
5 SASI_Rn01_00038831 predicted 429
6 SASI_Rn01_00038832 predicted 294
7 SASI_Rn01_00038833 predicted 442
8 SASI_Rn01_00038834 predicted 226
9 SASI_Rn01_00038835 predicted 224
10 SASI_Rn01_00038836 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062515 predicted 563
2 SASI_Mm01_00062516 predicted 594
3 SASI_Mm02_00325610 predicted 462
4 SASI_Mm01_00062518 predicted 294
5 SASI_Mm01_00062519 predicted 360
6 SASI_Mm02_00325611 predicted 250
7 SASI_Mm01_00062520 predicted 199
8 SASI_Mm02_00325612 predicted 236
9 SASI_Mm01_00062522 predicted 289
10 SASI_Mm01_00062523 predicted 281
11 SASI_Mm01_00062517 predicted 603
12 SASI_Mm01_00062521 predicted 529
13 SASI_Mm01_00062524 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020566
VALIDATED
DNAJC4 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020566.1-364s21c1
Sequence:CCGGCGAGCCTAAGTATACGCAACACTCGAGTGTTGCGTATACTTAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020566.1-572s21c1
Sequence:CCGGCATCGCAGCTTCATGGATGAACTCGAGTTCATCCATGAAGCTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020566.1-168s21c1
Sequence:CCGGCTGAAGAGATTAAACGTGCTTCTCGAGAAGCACGTTTAATCTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020566.1-119s21c1
Sequence:CCGGGTCCCTACTAATTACTATGAACTCGAGTTCATAGTAATTAGTAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020566.1-598s1c1
Sequence:CCGGCCGGATCATTACAGCCATCTACTCGAGTAGATGGCTGTAATGATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020566.1-364s1c1
Sequence:CCGGCGAGCCTAAGTATACGCAACACTCGAGTGTTGCGTATACTTAGGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020566.1-119s1c1
Sequence:CCGGGTCCCTACTAATTACTATGAACTCGAGTTCATAGTAATTAGTAGGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020566.1-168s1c1
Sequence:CCGGCTGAAGAGATTAAACGTGCTTCTCGAGAAGCACGTTTAATCTCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020566.1-572s1c1
Sequence:CCGGCATCGCAGCTTCATGGATGAACTCGAGTTCATCCATGAAGCTGCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020566
VALIDATED
DNAJC4 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020566.1-364s21c1
Sequence:CCGGCGAGCCTAAGTATACGCAACACTCGAGTGTTGCGTATACTTAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020566.1-572s21c1
Sequence:CCGGCATCGCAGCTTCATGGATGAACTCGAGTTCATCCATGAAGCTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020566.1-168s21c1
Sequence:CCGGCTGAAGAGATTAAACGTGCTTCTCGAGAAGCACGTTTAATCTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020566.1-119s21c1
Sequence:CCGGGTCCCTACTAATTACTATGAACTCGAGTTCATAGTAATTAGTAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020566.1-598s1c1
Sequence:CCGGCCGGATCATTACAGCCATCTACTCGAGTAGATGGCTGTAATGATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020566.1-364s1c1
Sequence:CCGGCGAGCCTAAGTATACGCAACACTCGAGTGTTGCGTATACTTAGGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020566.1-119s1c1
Sequence:CCGGGTCCCTACTAATTACTATGAACTCGAGTTCATAGTAATTAGTAGGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020566.1-168s1c1
Sequence:CCGGCTGAAGAGATTAAACGTGCTTCTCGAGAAGCACGTTTAATCTCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020566.1-572s1c1
Sequence:CCGGCATCGCAGCTTCATGGATGAACTCGAGTTCATCCATGAAGCTGCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020566
VALIDATED
DNAJC4 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020566.1-364s21c1
Sequence:CCGGCGAGCCTAAGTATACGCAACACTCGAGTGTTGCGTATACTTAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020566.1-572s21c1
Sequence:CCGGCATCGCAGCTTCATGGATGAACTCGAGTTCATCCATGAAGCTGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020566.1-168s21c1
Sequence:CCGGCTGAAGAGATTAAACGTGCTTCTCGAGAAGCACGTTTAATCTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020566.1-119s21c1
Sequence:CCGGGTCCCTACTAATTACTATGAACTCGAGTTCATAGTAATTAGTAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020566.1-598s1c1
Sequence:CCGGCCGGATCATTACAGCCATCTACTCGAGTAGATGGCTGTAATGATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020566.1-364s1c1
Sequence:CCGGCGAGCCTAAGTATACGCAACACTCGAGTGTTGCGTATACTTAGGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020566.1-119s1c1
Sequence:CCGGGTCCCTACTAATTACTATGAACTCGAGTTCATAGTAATTAGTAGGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020566.1-168s1c1
Sequence:CCGGCTGAAGAGATTAAACGTGCTTCTCGAGAAGCACGTTTAATCTCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020566.1-572s1c1
Sequence:CCGGCATCGCAGCTTCATGGATGAACTCGAGTTCATCCATGAAGCTGCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005528
VALIDATED
DNAJC4 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005528.3-595s21c1
Sequence:CCGGGCCAGCACTGAGGAAGTTAAACTCGAGTTTAACTTCCTCAGTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005528.3-896s21c1
Sequence:CCGGTGAGGCAGCAGCAACACAAACCTCGAGGTTTGTGTTGCTGCTGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005528.3-848s21c1
Sequence:CCGGCACAGTACTGGTCCCAGTTTCCTCGAGGAAACTGGGACCAGTACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005528.3-549s21c1
Sequence:CCGGGTCCAGACCCAGTACTTATTACTCGAGTAATAAGTACTGGGTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005528.3-783s21c1
Sequence:CCGGTCCACGAACCACAGTCCATGACTCGAGTCATGGACTGTGGTTCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005528.1-913s1c1
Sequence:CCGGCCGCAGCTATGATGACCAGCTCTCGAGAGCTGGTCATCATAGCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005528.1-973s1c1
Sequence:CCGGCCATGACAAGTCTGCCCACCACTCGAGTGGTGGGCAGACTTGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_005528.1-1143s1c1
Sequence:CCGGGCCTGCACTACATTGCCTTCACTCGAGTGAAGGCAATGTAGTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005528
VALIDATED
DNAJC4 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005528.3-595s21c1
Sequence:CCGGGCCAGCACTGAGGAAGTTAAACTCGAGTTTAACTTCCTCAGTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005528.3-896s21c1
Sequence:CCGGTGAGGCAGCAGCAACACAAACCTCGAGGTTTGTGTTGCTGCTGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005528.3-848s21c1
Sequence:CCGGCACAGTACTGGTCCCAGTTTCCTCGAGGAAACTGGGACCAGTACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005528.3-549s21c1
Sequence:CCGGGTCCAGACCCAGTACTTATTACTCGAGTAATAAGTACTGGGTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005528.3-783s21c1
Sequence:CCGGTCCACGAACCACAGTCCATGACTCGAGTCATGGACTGTGGTTCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005528.1-913s1c1
Sequence:CCGGCCGCAGCTATGATGACCAGCTCTCGAGAGCTGGTCATCATAGCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005528.1-973s1c1
Sequence:CCGGCCATGACAAGTCTGCCCACCACTCGAGTGGTGGGCAGACTTGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_005528.1-1143s1c1
Sequence:CCGGGCCTGCACTACATTGCCTTCACTCGAGTGAAGGCAATGTAGTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005528
VALIDATED
DNAJC4 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005528.3-595s21c1
Sequence:CCGGGCCAGCACTGAGGAAGTTAAACTCGAGTTTAACTTCCTCAGTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005528.3-896s21c1
Sequence:CCGGTGAGGCAGCAGCAACACAAACCTCGAGGTTTGTGTTGCTGCTGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005528.3-848s21c1
Sequence:CCGGCACAGTACTGGTCCCAGTTTCCTCGAGGAAACTGGGACCAGTACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005528.3-549s21c1
Sequence:CCGGGTCCAGACCCAGTACTTATTACTCGAGTAATAAGTACTGGGTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005528.3-783s21c1
Sequence:CCGGTCCACGAACCACAGTCCATGACTCGAGTCATGGACTGTGGTTCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005528.1-913s1c1
Sequence:CCGGCCGCAGCTATGATGACCAGCTCTCGAGAGCTGGTCATCATAGCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005528.1-973s1c1
Sequence:CCGGCCATGACAAGTCTGCCCACCACTCGAGTGGTGGGCAGACTTGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_005528.1-1143s1c1
Sequence:CCGGGCCTGCACTACATTGCCTTCACTCGAGTGAAGGCAATGTAGTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks