EMAIL THIS PAGE TO A FRIEND

DNAJC5

DnaJ (Hsp40) homolog, subfamily C, member 5

86 Gene Product Result for
Synonyms: CLN4 CLN4B CSP DNAJC5A NCL
UniProtKB ID: Q9H3Z4, A8K0M0, B3KY68, E1P5G8, Q9H3Z5, Q9H7H2
Gene ID:
Human(80331) Summary: This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. The encoded protein plays a role in membrane trafficking and protein folding, and has been shown to have anti-neurodegenerative properties. The encoded protein is known to play a role in cystic fibrosis and Huntington's disease. A pseudogene of this gene is located on the short arm of chromosome 8. [provided by RefSeq, Nov 2010]
Mouse(13002) DnaJ (Hsp40) homolog, subfamily C, member 5
Rat(79130) DnaJ (Hsp40) homolog, subfamily C, member 5
chicken(419256) DnaJ (Hsp40) homolog, subfamily C, member 5
cow(282216) DnaJ (Hsp40) homolog, subfamily C, member 5
domestic cat(101092017) DnaJ (Hsp40) homolog, subfamily C, member 5
dog(485982) DnaJ (Hsp40) homolog, subfamily C, member 5
sheep(101108591) DnaJ (Hsp40) homolog, subfamily C, member 5
naked mole-rat(101700492) DnaJ (Hsp40) homolog, subfamily C, member 5
domestic guinea pig(100728482) DnaJ (Hsp40) homolog, subfamily C, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025219 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025219 Rosetta Predictions human pricing
NM_024161 Rosetta Predictions rat pricing
NM_016775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200577 predicted 272
2 SASI_Hs01_00200578 predicted 933
3 SASI_Hs01_00200579 predicted 929
4 SASI_Hs02_00358009 predicted 466
5 SASI_Hs02_00358010 predicted 746
6 SASI_Hs02_00358011 predicted 239
7 SASI_Hs01_00200581 predicted 666
8 SASI_Hs01_00200583 predicted 323
9 SASI_Hs01_00200584 predicted 807
10 SASI_Hs01_00200585 predicted 818
11 SASI_Hs01_00200580 predicted 243
12 SASI_Hs01_00200582 predicted 184
13 SASI_Hs01_00200586 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024161 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114499 predicted 687
2 SASI_Rn01_00114500 predicted 276
3 SASI_Rn01_00114501 predicted 253
4 SASI_Rn01_00114502 predicted 230
5 SASI_Rn01_00114503 predicted 420
6 SASI_Rn01_00114504 predicted 225
7 SASI_Rn01_00114505 predicted 621
8 SASI_Rn01_00114506 predicted 534
9 SASI_Rn01_00114508 predicted 256
10 SASI_Rn02_00263896 predicted 572
11 SASI_Rn01_00114507 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091078 predicted 947
2 SASI_Mm01_00091079 predicted 968
3 SASI_Mm01_00091080 predicted 978
4 SASI_Mm01_00091081 predicted 1004
5 SASI_Mm01_00091082 predicted 1236
6 SASI_Mm01_00091083 predicted 1039
7 SASI_Mm01_00091084 predicted 279
8 SASI_Mm02_00323542 predicted 950
9 SASI_Mm01_00091085 predicted 330
10 SASI_Mm01_00091086 predicted 1088
11 SASI_Mm01_00091087 predicted 277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016775
VALIDATED
DNAJC5 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 5
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016775.1-51s1c1
Sequence:CCGGCCATGTTCTTGGACTGGACAACTCGAGTTGTCCAGTCCAAGAACATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016775.1-177s1c1
Sequence:CCGGGATTAACAACGCACACGCCATCTCGAGATGGCGTGTGCGTTGTTAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016775.1-431s1c1
Sequence:CCGGAGGAGACAGAATTCTACGTATCTCGAGATACGTAGAATTCTGTCTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016775.1-72s1c1
Sequence:CCGGGAATGCAACCTCAGATGACATCTCGAGATGTCATCTGAGGTTGCATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016775.1-377s1c1
Sequence:CCGGGCTGTTGCTTTAACTGCTGCTCTCGAGAGCAGCAGTTAAAGCAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016775.2-783s21c1
Sequence:CCGGCACCGACGGGTTCAACTAAATCTCGAGATTTAGTTGAACCCGTCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016775.2-481s21c1
Sequence:CCGGGAGAACGTCAACACCTACTTCCTCGAGGAAGTAGGTGTTGACGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016775.2-813s21c1
Sequence:CCGGGCTGTGATTAGAGGATGAATCCTCGAGGATTCATCCTCTAATCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016775.2-522s21c1
Sequence:CCGGCAAGGCGCTGTTTGTTGTTTGCTCGAGCAAACAACAAACAGCGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016775.2-1038s21c1
Sequence:CCGGTAATAGCATGTATGGGTTATGCTCGAGCATAACCCATACATGCTATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016775.2-1102s21c1
Sequence:CCGGACTGGATGGTAGTGCTTATTTCTCGAGAAATAAGCACTACCATCCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016775.2-455s21c1
Sequence:CCGGTCTATGTGGCGGAGCAGTTTGCTCGAGCAAACTGCTCCGCCACATAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016775
VALIDATED
DNAJC5 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 5
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016775.1-51s1c1
Sequence:CCGGCCATGTTCTTGGACTGGACAACTCGAGTTGTCCAGTCCAAGAACATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016775.1-177s1c1
Sequence:CCGGGATTAACAACGCACACGCCATCTCGAGATGGCGTGTGCGTTGTTAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016775.1-431s1c1
Sequence:CCGGAGGAGACAGAATTCTACGTATCTCGAGATACGTAGAATTCTGTCTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016775.1-72s1c1
Sequence:CCGGGAATGCAACCTCAGATGACATCTCGAGATGTCATCTGAGGTTGCATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016775.1-377s1c1
Sequence:CCGGGCTGTTGCTTTAACTGCTGCTCTCGAGAGCAGCAGTTAAAGCAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016775.2-783s21c1
Sequence:CCGGCACCGACGGGTTCAACTAAATCTCGAGATTTAGTTGAACCCGTCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016775.2-481s21c1
Sequence:CCGGGAGAACGTCAACACCTACTTCCTCGAGGAAGTAGGTGTTGACGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016775.2-813s21c1
Sequence:CCGGGCTGTGATTAGAGGATGAATCCTCGAGGATTCATCCTCTAATCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016775.2-522s21c1
Sequence:CCGGCAAGGCGCTGTTTGTTGTTTGCTCGAGCAAACAACAAACAGCGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016775.2-1038s21c1
Sequence:CCGGTAATAGCATGTATGGGTTATGCTCGAGCATAACCCATACATGCTATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016775.2-1102s21c1
Sequence:CCGGACTGGATGGTAGTGCTTATTTCTCGAGAAATAAGCACTACCATCCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016775.2-455s21c1
Sequence:CCGGTCTATGTGGCGGAGCAGTTTGCTCGAGCAAACTGCTCCGCCACATAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016775
VALIDATED
DNAJC5 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 5
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016775.1-51s1c1
Sequence:CCGGCCATGTTCTTGGACTGGACAACTCGAGTTGTCCAGTCCAAGAACATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016775.1-177s1c1
Sequence:CCGGGATTAACAACGCACACGCCATCTCGAGATGGCGTGTGCGTTGTTAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016775.1-431s1c1
Sequence:CCGGAGGAGACAGAATTCTACGTATCTCGAGATACGTAGAATTCTGTCTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016775.1-72s1c1
Sequence:CCGGGAATGCAACCTCAGATGACATCTCGAGATGTCATCTGAGGTTGCATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016775.1-377s1c1
Sequence:CCGGGCTGTTGCTTTAACTGCTGCTCTCGAGAGCAGCAGTTAAAGCAACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016775.2-783s21c1
Sequence:CCGGCACCGACGGGTTCAACTAAATCTCGAGATTTAGTTGAACCCGTCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016775.2-481s21c1
Sequence:CCGGGAGAACGTCAACACCTACTTCCTCGAGGAAGTAGGTGTTGACGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016775.2-813s21c1
Sequence:CCGGGCTGTGATTAGAGGATGAATCCTCGAGGATTCATCCTCTAATCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016775.2-522s21c1
Sequence:CCGGCAAGGCGCTGTTTGTTGTTTGCTCGAGCAAACAACAAACAGCGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016775.2-1038s21c1
Sequence:CCGGTAATAGCATGTATGGGTTATGCTCGAGCATAACCCATACATGCTATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016775.2-1102s21c1
Sequence:CCGGACTGGATGGTAGTGCTTATTTCTCGAGAAATAAGCACTACCATCCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016775.2-455s21c1
Sequence:CCGGTCTATGTGGCGGAGCAGTTTGCTCGAGCAAACTGCTCCGCCACATAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025219
VALIDATED
DNAJC5 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_025219.1-329s1c1
Sequence:CCGGCGCGGACAAGTTTAAGGAGATCTCGAGATCTCCTTAAACTTGTCCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025219.1-210s1c1
Sequence:CCGGGAGTCATTGTACCACGTCCTTCTCGAGAAGGACGTGGTACAATGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025219.1-444s1c1
Sequence:CCGGGAAGAGAACGTGAACACCTACCTCGAGGTAGGTGTTCACGTTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_025219.1-242s1c1
Sequence:CCGGGAACGCAACCTCAGATGACATCTCGAGATGTCATCTGAGGTTGCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025219.1-272s1c1
Sequence:CCGGCTATCGGAAGCTTGCCTTGAACTCGAGTTCAAGGCAAGCTTCCGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_025219.1-2626s1c1
Sequence:CCGGGCAGCTTTGTTTGTCCCACTTCTCGAGAAGTGGGACAAACAAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_025219.1-812s1c1
Sequence:CCGGCGCCAACCTTAGAATCATGAACTCGAGTTCATGATTCTAAGGTTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025219.1-278s1c1
Sequence:CCGGGAAGCTTGCCTTGAAATATCACTCGAGTGATATTTCAAGGCAAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025219.1-246s1c1
Sequence:CCGGGCAACCTCAGATGACATTAAACTCGAGTTTAATGTCATCTGAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025219.1-2627s1c1
Sequence:CCGGCAGCTTTGTTTGTCCCACTTTCTCGAGAAAGTGGGACAAACAAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025219.1-245s1c1
Sequence:CCGGCGCAACCTCAGATGACATTAACTCGAGTTAATGTCATCTGAGGTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025219.1-331s1c1
Sequence:CCGGCGGACAAGTTTAAGGAGATCACTCGAGTGATCTCCTTAAACTTGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025219
VALIDATED
DNAJC5 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_025219.1-329s1c1
Sequence:CCGGCGCGGACAAGTTTAAGGAGATCTCGAGATCTCCTTAAACTTGTCCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025219.1-210s1c1
Sequence:CCGGGAGTCATTGTACCACGTCCTTCTCGAGAAGGACGTGGTACAATGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025219.1-444s1c1
Sequence:CCGGGAAGAGAACGTGAACACCTACCTCGAGGTAGGTGTTCACGTTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_025219.1-242s1c1
Sequence:CCGGGAACGCAACCTCAGATGACATCTCGAGATGTCATCTGAGGTTGCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025219.1-272s1c1
Sequence:CCGGCTATCGGAAGCTTGCCTTGAACTCGAGTTCAAGGCAAGCTTCCGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_025219.1-2626s1c1
Sequence:CCGGGCAGCTTTGTTTGTCCCACTTCTCGAGAAGTGGGACAAACAAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_025219.1-812s1c1
Sequence:CCGGCGCCAACCTTAGAATCATGAACTCGAGTTCATGATTCTAAGGTTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025219.1-278s1c1
Sequence:CCGGGAAGCTTGCCTTGAAATATCACTCGAGTGATATTTCAAGGCAAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025219.1-246s1c1
Sequence:CCGGGCAACCTCAGATGACATTAAACTCGAGTTTAATGTCATCTGAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025219.1-2627s1c1
Sequence:CCGGCAGCTTTGTTTGTCCCACTTTCTCGAGAAAGTGGGACAAACAAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025219.1-245s1c1
Sequence:CCGGCGCAACCTCAGATGACATTAACTCGAGTTAATGTCATCTGAGGTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025219.1-331s1c1
Sequence:CCGGCGGACAAGTTTAAGGAGATCACTCGAGTGATCTCCTTAAACTTGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025219
VALIDATED
DNAJC5 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_025219.1-329s1c1
Sequence:CCGGCGCGGACAAGTTTAAGGAGATCTCGAGATCTCCTTAAACTTGTCCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025219.1-210s1c1
Sequence:CCGGGAGTCATTGTACCACGTCCTTCTCGAGAAGGACGTGGTACAATGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025219.1-444s1c1
Sequence:CCGGGAAGAGAACGTGAACACCTACCTCGAGGTAGGTGTTCACGTTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_025219.1-242s1c1
Sequence:CCGGGAACGCAACCTCAGATGACATCTCGAGATGTCATCTGAGGTTGCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025219.1-272s1c1
Sequence:CCGGCTATCGGAAGCTTGCCTTGAACTCGAGTTCAAGGCAAGCTTCCGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_025219.1-2626s1c1
Sequence:CCGGGCAGCTTTGTTTGTCCCACTTCTCGAGAAGTGGGACAAACAAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_025219.1-812s1c1
Sequence:CCGGCGCCAACCTTAGAATCATGAACTCGAGTTCATGATTCTAAGGTTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025219.1-278s1c1
Sequence:CCGGGAAGCTTGCCTTGAAATATCACTCGAGTGATATTTCAAGGCAAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025219.1-246s1c1
Sequence:CCGGGCAACCTCAGATGACATTAAACTCGAGTTTAATGTCATCTGAGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025219.1-2627s1c1
Sequence:CCGGCAGCTTTGTTTGTCCCACTTTCTCGAGAAAGTGGGACAAACAAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025219.1-245s1c1
Sequence:CCGGCGCAACCTCAGATGACATTAACTCGAGTTAATGTCATCTGAGGTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025219.1-331s1c1
Sequence:CCGGCGGACAAGTTTAAGGAGATCACTCGAGTGATCTCCTTAAACTTGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)