EMAIL THIS PAGE TO A FRIEND

DNAJC5B

DnaJ (Hsp40) homolog, subfamily C, member 5 beta

59 Gene Product Result for
Synonyms: CSP-beta
UniProtKB ID: Q9UF47, Q969Y8
Gene ID:
Mouse(66326) DnaJ (Hsp40) homolog, subfamily C, member 5 beta
Rat(499579) DnaJ (Hsp40) homolog, subfamily C, member 5 beta
Zebrafish(571681) DnaJ (Hsp40) homolog, subfamily C, member 5 beta
cow(525222) DnaJ (Hsp40) homolog, subfamily C, member 5 beta
domestic cat(101087900) DnaJ (Hsp40) homolog, subfamily C, member 5 beta
chicken(428358) DnaJ (Hsp40) homolog, subfamily C, member 5 beta
dog(610015) DnaJ (Hsp40) homolog, subfamily C, member 5 beta
domestic guinea pig(100720031) DnaJ (Hsp40) homolog, subfamily C, member 5 beta
naked mole-rat(101718761) DnaJ (Hsp40) homolog, subfamily C, member 5 beta
sheep(101120672) DnaJ (Hsp40) homolog, subfamily C, member 5 beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033105 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025489 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025489 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025489 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046751 MISSION® esiRNA esiRNA human DNAJC5B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033105 Rosetta Predictions human pricing
NM_001109180 Rosetta Predictions rat pricing
NM_025489 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208684 predicted 1050
2 SASI_Hs01_00208685 predicted 1146
3 SASI_Hs01_00208686 predicted 1136
4 SASI_Hs01_00208687 predicted 337
5 SASI_Hs01_00208689 predicted 362
6 SASI_Hs01_00208690 predicted 1147
7 SASI_Hs01_00208691 predicted 347
8 SASI_Hs01_00208692 predicted 335
9 SASI_Hs01_00208693 predicted 913
10 SASI_Hs02_00360813 predicted 317
11 SASI_Hs01_00208688 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245910 predicted 302
2 SASI_Rn02_00245911 predicted 245
3 SASI_Rn02_00245912 predicted 558
4 SASI_Rn02_00245913 predicted 250
5 SASI_Rn02_00245914 predicted 665
6 SASI_Rn02_00245915 predicted 484
7 SASI_Rn02_00245916 predicted 224
8 SASI_Rn02_00245917 predicted 535
9 SASI_Rn02_00245918 predicted 478
10 SASI_Rn02_00245919 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195937 predicted 642
2 SASI_Mm01_00195938 predicted 391
3 SASI_Mm01_00195939 predicted 334
4 SASI_Mm01_00195940 predicted 450
5 SASI_Mm01_00195942 predicted 323
6 SASI_Mm02_00328360 predicted 407
7 SASI_Mm01_00195943 predicted 629
8 SASI_Mm01_00195944 predicted 529
9 SASI_Mm01_00195945 predicted 483
10 SASI_Mm01_00195946 predicted 625
11 SASI_Mm01_00195941 predicted 366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033105
DNAJC5B MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 5 beta
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033105.3-768s1c1
Sequence:CCGGGCAGATCAAGTCTGACATGGACTCGAGTCCATGTCAGACTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033105.3-516s1c1
Sequence:CCGGGAGAAGCATATACGACAAGTACTCGAGTACTTGTCGTATATGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033105.3-351s1c1
Sequence:CCGGCGAAATTCTTGGTCTGCATAACTCGAGTTATGCAGACCAAGAATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033105.3-504s1c1
Sequence:CCGGCGACATTTCAAAGAGAAGCATCTCGAGATGCTTCTCTTTGAAATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033105.3-454s1c1
Sequence:CCGGGCTGCTACTGAGAAGTTTAAACTCGAGTTTAAACTTCTCAGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033105
DNAJC5B MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 5 beta
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033105.3-768s1c1
Sequence:CCGGGCAGATCAAGTCTGACATGGACTCGAGTCCATGTCAGACTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033105.3-516s1c1
Sequence:CCGGGAGAAGCATATACGACAAGTACTCGAGTACTTGTCGTATATGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033105.3-351s1c1
Sequence:CCGGCGAAATTCTTGGTCTGCATAACTCGAGTTATGCAGACCAAGAATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033105.3-504s1c1
Sequence:CCGGCGACATTTCAAAGAGAAGCATCTCGAGATGCTTCTCTTTGAAATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033105.3-454s1c1
Sequence:CCGGGCTGCTACTGAGAAGTTTAAACTCGAGTTTAAACTTCTCAGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033105
DNAJC5B MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 5 beta
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033105.3-768s1c1
Sequence:CCGGGCAGATCAAGTCTGACATGGACTCGAGTCCATGTCAGACTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033105.3-516s1c1
Sequence:CCGGGAGAAGCATATACGACAAGTACTCGAGTACTTGTCGTATATGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033105.3-351s1c1
Sequence:CCGGCGAAATTCTTGGTCTGCATAACTCGAGTTATGCAGACCAAGAATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033105.3-504s1c1
Sequence:CCGGCGACATTTCAAAGAGAAGCATCTCGAGATGCTTCTCTTTGAAATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033105.3-454s1c1
Sequence:CCGGGCTGCTACTGAGAAGTTTAAACTCGAGTTTAAACTTCTCAGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025489
DNAJC5B MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 5 beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025489.2-748s1c1
Sequence:CCGGGCTGTGAACATATTCACATTTCTCGAGAAATGTGAATATGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025489.2-461s1c1
Sequence:CCGGGCAACTGTTGTTGTGGACATTCTCGAGAATGTCCACAACAACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025489.2-591s1c1
Sequence:CCGGCCAGCCTACAAATACAAATGACTCGAGTCATTTGTATTTGTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025489.2-196s1c1
Sequence:CCGGCGACACCATCCAGACAAGAATCTCGAGATTCTTGTCTGGATGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025489.2-335s1c1
Sequence:CCGGCTGAACAATTTGGAGATGAAACTCGAGTTTCATCTCCAAATTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025489
DNAJC5B MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 5 beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025489.2-748s1c1
Sequence:CCGGGCTGTGAACATATTCACATTTCTCGAGAAATGTGAATATGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025489.2-461s1c1
Sequence:CCGGGCAACTGTTGTTGTGGACATTCTCGAGAATGTCCACAACAACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025489.2-591s1c1
Sequence:CCGGCCAGCCTACAAATACAAATGACTCGAGTCATTTGTATTTGTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025489.2-196s1c1
Sequence:CCGGCGACACCATCCAGACAAGAATCTCGAGATTCTTGTCTGGATGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025489.2-335s1c1
Sequence:CCGGCTGAACAATTTGGAGATGAAACTCGAGTTTCATCTCCAAATTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025489
DNAJC5B MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 5 beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025489.2-748s1c1
Sequence:CCGGGCTGTGAACATATTCACATTTCTCGAGAAATGTGAATATGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025489.2-461s1c1
Sequence:CCGGGCAACTGTTGTTGTGGACATTCTCGAGAATGTCCACAACAACAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025489.2-591s1c1
Sequence:CCGGCCAGCCTACAAATACAAATGACTCGAGTCATTTGTATTTGTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025489.2-196s1c1
Sequence:CCGGCGACACCATCCAGACAAGAATCTCGAGATTCTTGTCTGGATGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025489.2-335s1c1
Sequence:CCGGCTGAACAATTTGGAGATGAAACTCGAGTTTCATCTCCAAATTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks