EMAIL THIS PAGE TO A FRIEND

DNAJC5G

DnaJ (Hsp40) homolog, subfamily C, member 5 gamma

53 Gene Product Result for
Synonyms: CSP-gamma
UniProtKB ID: Q8N7S2, Q53SY5, Q8IYQ4, Q96RJ8
Gene ID:
Mouse(231098) DnaJ (Hsp40) homolog, subfamily C, member 5 gamma
Rat(366567) DnaJ (Hsp40) homolog, subfamily C, member 5 gamma
sheep(101116034) DnaJ (Hsp40) homolog, subfamily C, member 5 gamma
naked mole-rat(101711964) DnaJ (Hsp40) homolog, subfamily C, member 5 gamma
domestic guinea pig(100727413) DnaJ (Hsp40) homolog, subfamily C, member 5 gamma
dog(611034) DnaJ (Hsp40) homolog, subfamily C, member 5 gamma
cow(616608) DnaJ (Hsp40) homolog, subfamily C, member 5 gamma
domestic cat(101090855) DnaJ (Hsp40) homolog, subfamily C, member 5 gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173650 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173650 Rosetta Predictions human pricing
NM_001013242 Rosetta Predictions rat pricing
NM_177677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150068 predicted 1170
2 SASI_Hs01_00150069 predicted 1327
3 SASI_Hs01_00150070 predicted 1391
4 SASI_Hs02_00368554 predicted 1073
5 SASI_Hs02_00368555 predicted 1220
6 SASI_Hs01_00150071 predicted 1076
7 SASI_Hs01_00150072 predicted 1466
8 SASI_Hs01_00150073 predicted 1217
9 SASI_Hs01_00150075 predicted 1128
10 SASI_Hs01_00150077 predicted 1178
11 SASI_Hs01_00150074 predicted 1469
12 SASI_Hs01_00150076 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071124 predicted 997
2 SASI_Rn01_00071125 predicted 697
3 SASI_Rn01_00071126 predicted 990
4 SASI_Rn01_00071128 predicted 682
5 SASI_Rn01_00071129 predicted 686
6 SASI_Rn01_00071130 predicted 858
7 SASI_Rn01_00071131 predicted 636
8 SASI_Rn01_00071132 predicted 823
9 SASI_Rn01_00071133 predicted 869
10 SASI_Rn02_00201067 predicted 964
11 SASI_Rn01_00071127 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347990 predicted 406
2 SASI_Mm02_00347991 predicted 260
3 SASI_Mm02_00347992 predicted 483
4 SASI_Mm02_00347993 predicted 595
5 SASI_Mm02_00347994 predicted 286
6 SASI_Mm02_00347995 predicted 575
7 SASI_Mm02_00347996 predicted 297
8 SASI_Mm02_00347997 predicted 353
9 SASI_Mm02_00347998 predicted 330
10 SASI_Mm02_00347999 predicted 524
11 SASI_Mm01_00069542 predicted 1010
12 SASI_Mm01_00069543 predicted 1079
13 SASI_Mm01_00069544 predicted 729
14 SASI_Mm01_00069545 predicted 711
15 SASI_Mm01_00069546 predicted 1016
16 SASI_Mm01_00069547 predicted 899
17 SASI_Mm01_00069548 predicted 883
18 SASI_Mm01_00069549 predicted 910
19 SASI_Mm01_00069550 predicted 217
20 SASI_Mm01_00069551 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177677
DNAJC5G MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 5 gamma
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115366    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177677.2-1239s1c1
Sequence:CCGGCCATCCTTAAACCCATTATTACTCGAGTAATAATGGGTTTAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177677.2-347s1c1
Sequence:CCGGGCACGGCTCACTAGGATTATACTCGAGTATAATCCTAGTGAGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177677.2-134s1c1
Sequence:CCGGGCGACTATCTAGAACTGGGAACTCGAGTTCCCAGTTCTAGATAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177677.2-496s1c1
Sequence:CCGGGCTGTGGTAGACTTAATCCATCTCGAGATGGATTAAGTCTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177677.2-454s1c1
Sequence:CCGGGCTTGCTCACTGGTTGTTGTTCTCGAGAACAACAACCAGTGAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177677.3-219s21c1
Sequence:CCGGGGAAACTGGCCTTGCAATATCCTCGAGGATATTGCAAGGCCAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177677.3-424s21c1
Sequence:CCGGTTGGTTCAAGACACTTGTTATCTCGAGATAACAAGTGTCTTGAACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177677.3-670s21c1
Sequence:CCGGCTCAGCCCACTGGATACATTGCTCGAGCAATGTATCCAGTGGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177677.3-585s21c1
Sequence:CCGGATATTGAAGCAGAGGATTAAGCTCGAGCTTAATCCTCTGCTTCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177677.3-388s21c1
Sequence:CCGGAGAAGGTGTCCGATTCTATTTCTCGAGAAATAGAATCGGACACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177677
DNAJC5G MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 5 gamma
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115366    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177677.2-1239s1c1
Sequence:CCGGCCATCCTTAAACCCATTATTACTCGAGTAATAATGGGTTTAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177677.2-347s1c1
Sequence:CCGGGCACGGCTCACTAGGATTATACTCGAGTATAATCCTAGTGAGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177677.2-134s1c1
Sequence:CCGGGCGACTATCTAGAACTGGGAACTCGAGTTCCCAGTTCTAGATAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177677.2-496s1c1
Sequence:CCGGGCTGTGGTAGACTTAATCCATCTCGAGATGGATTAAGTCTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177677.2-454s1c1
Sequence:CCGGGCTTGCTCACTGGTTGTTGTTCTCGAGAACAACAACCAGTGAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177677.3-219s21c1
Sequence:CCGGGGAAACTGGCCTTGCAATATCCTCGAGGATATTGCAAGGCCAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177677.3-424s21c1
Sequence:CCGGTTGGTTCAAGACACTTGTTATCTCGAGATAACAAGTGTCTTGAACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177677.3-670s21c1
Sequence:CCGGCTCAGCCCACTGGATACATTGCTCGAGCAATGTATCCAGTGGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177677.3-585s21c1
Sequence:CCGGATATTGAAGCAGAGGATTAAGCTCGAGCTTAATCCTCTGCTTCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177677.3-388s21c1
Sequence:CCGGAGAAGGTGTCCGATTCTATTTCTCGAGAAATAGAATCGGACACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177677
DNAJC5G MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 5 gamma
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115366    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177677.2-1239s1c1
Sequence:CCGGCCATCCTTAAACCCATTATTACTCGAGTAATAATGGGTTTAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177677.2-347s1c1
Sequence:CCGGGCACGGCTCACTAGGATTATACTCGAGTATAATCCTAGTGAGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177677.2-134s1c1
Sequence:CCGGGCGACTATCTAGAACTGGGAACTCGAGTTCCCAGTTCTAGATAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177677.2-496s1c1
Sequence:CCGGGCTGTGGTAGACTTAATCCATCTCGAGATGGATTAAGTCTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177677.2-454s1c1
Sequence:CCGGGCTTGCTCACTGGTTGTTGTTCTCGAGAACAACAACCAGTGAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177677.3-219s21c1
Sequence:CCGGGGAAACTGGCCTTGCAATATCCTCGAGGATATTGCAAGGCCAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177677.3-424s21c1
Sequence:CCGGTTGGTTCAAGACACTTGTTATCTCGAGATAACAAGTGTCTTGAACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177677.3-670s21c1
Sequence:CCGGCTCAGCCCACTGGATACATTGCTCGAGCAATGTATCCAGTGGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177677.3-585s21c1
Sequence:CCGGATATTGAAGCAGAGGATTAAGCTCGAGCTTAATCCTCTGCTTCAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177677.3-388s21c1
Sequence:CCGGAGAAGGTGTCCGATTCTATTTCTCGAGAAATAGAATCGGACACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173650
DNAJC5G MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 5 gamma
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173650.1-746s1c1
Sequence:CCGGGAAGAAGGCGTCAGATACTATCTCGAGATAGTATCTGACGCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173650.1-706s1c1
Sequence:CCGGGCATGGCTCATTGGGAATATACTCGAGTATATTCCCAATGAGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173650.1-783s1c1
Sequence:CCGGGTTGGTTCAAGACACTTGTCACTCGAGTGACAAGTGTCTTGAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173650.1-934s1c1
Sequence:CCGGGTCAGGAGCCAAATGTGATTTCTCGAGAAATCACATTTGGCTCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173650.1-1223s1c1
Sequence:CCGGCCTTTCAGTTGCAGTCCCAATCTCGAGATTGGGACTGCAACTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173650.1-813s1c1
Sequence:CCGGCTCTGCTCACTTGTTGCTGTTCTCGAGAACAGCAACAAGTGAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173650.1-500s1c1
Sequence:CCGGGCCTCACCTGAAGACTTCAAACTCGAGTTTGAAGTCTTCAGGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140190    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173650.1-1079s1c1
Sequence:CCGGGTCCTGACATTGACCCTGATTCTCGAGAATCAGGGTCAATGTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173650.1-563s1c1
Sequence:CCGGGAGTATCACCTGGGTAGGAAACTCGAGTTTCCTACCCAGGTGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173650.1-1511s1c1
Sequence:CCGGCTAAGCCAATAACGCCTGTATCTCGAGATACAGGCGTTATTGGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173650
DNAJC5G MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 5 gamma
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173650.1-746s1c1
Sequence:CCGGGAAGAAGGCGTCAGATACTATCTCGAGATAGTATCTGACGCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173650.1-706s1c1
Sequence:CCGGGCATGGCTCATTGGGAATATACTCGAGTATATTCCCAATGAGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173650.1-783s1c1
Sequence:CCGGGTTGGTTCAAGACACTTGTCACTCGAGTGACAAGTGTCTTGAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173650.1-934s1c1
Sequence:CCGGGTCAGGAGCCAAATGTGATTTCTCGAGAAATCACATTTGGCTCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173650.1-1223s1c1
Sequence:CCGGCCTTTCAGTTGCAGTCCCAATCTCGAGATTGGGACTGCAACTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173650.1-813s1c1
Sequence:CCGGCTCTGCTCACTTGTTGCTGTTCTCGAGAACAGCAACAAGTGAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173650.1-500s1c1
Sequence:CCGGGCCTCACCTGAAGACTTCAAACTCGAGTTTGAAGTCTTCAGGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140190    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173650.1-1079s1c1
Sequence:CCGGGTCCTGACATTGACCCTGATTCTCGAGAATCAGGGTCAATGTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173650.1-563s1c1
Sequence:CCGGGAGTATCACCTGGGTAGGAAACTCGAGTTTCCTACCCAGGTGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173650.1-1511s1c1
Sequence:CCGGCTAAGCCAATAACGCCTGTATCTCGAGATACAGGCGTTATTGGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173650
DNAJC5G MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 5 gamma
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173650.1-746s1c1
Sequence:CCGGGAAGAAGGCGTCAGATACTATCTCGAGATAGTATCTGACGCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173650.1-706s1c1
Sequence:CCGGGCATGGCTCATTGGGAATATACTCGAGTATATTCCCAATGAGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173650.1-783s1c1
Sequence:CCGGGTTGGTTCAAGACACTTGTCACTCGAGTGACAAGTGTCTTGAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173650.1-934s1c1
Sequence:CCGGGTCAGGAGCCAAATGTGATTTCTCGAGAAATCACATTTGGCTCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173650.1-1223s1c1
Sequence:CCGGCCTTTCAGTTGCAGTCCCAATCTCGAGATTGGGACTGCAACTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173650.1-813s1c1
Sequence:CCGGCTCTGCTCACTTGTTGCTGTTCTCGAGAACAGCAACAAGTGAGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173650.1-500s1c1
Sequence:CCGGGCCTCACCTGAAGACTTCAAACTCGAGTTTGAAGTCTTCAGGTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140190    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173650.1-1079s1c1
Sequence:CCGGGTCCTGACATTGACCCTGATTCTCGAGAATCAGGGTCAATGTCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173650.1-563s1c1
Sequence:CCGGGAGTATCACCTGGGTAGGAAACTCGAGTTTCCTACCCAGGTGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173650.1-1511s1c1
Sequence:CCGGCTAAGCCAATAACGCCTGTATCTCGAGATACAGGCGTTATTGGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks