EMAIL THIS PAGE TO A FRIEND

DNAJC6

DnaJ (Hsp40) homolog, subfamily C, member 6

149 Gene Product Result for
Synonyms: DJC6
Gene ID:
Human(9829) Summary: DNAJC6 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus, a glycine/phenylalanine (G/F)-rich region, and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]
Mouse(72685) DnaJ (Hsp40) homolog, subfamily C, member 6
Rat(313409) DnaJ (Hsp40) homolog, subfamily C, member 6
Zebrafish(796345) DnaJ (Hsp40) homolog, subfamily C, member 6
chicken(424698) DnaJ (Hsp40) homolog, subfamily C, member 6
dog(489553) DnaJ (Hsp40) homolog, subfamily C, member 6
domestic cat(101084891) DnaJ (Hsp40) homolog, subfamily C, member 6
cow(317659) DnaJ (Hsp40) homolog, subfamily C, member 6
domestic guinea pig(100725701) DnaJ (Hsp40) homolog, subfamily C, member 6
naked mole-rat(101707904) DnaJ (Hsp40) homolog, subfamily C, member 6
sheep(101111237) DnaJ (Hsp40) homolog, subfamily C, member 6
Domestic Rabbit(100355560) DnaJ (Hsp40) homolog, subfamily C, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014787 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014787 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014787 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014787 Rosetta Predictions human pricing
NM_001107949 Rosetta Predictions rat pricing
NM_198412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152029 predicted 2020
2 SASI_Hs01_00152030 predicted 1146
3 SASI_Hs01_00152031 predicted 2566
4 SASI_Hs01_00152032 predicted 919
5 SASI_Hs01_00152033 predicted 1186
6 SASI_Hs01_00152034 predicted 2946
7 SASI_Hs01_00152035 predicted 728
8 SASI_Hs01_00152036 predicted 2854
9 SASI_Hs01_00152038 predicted 838
10 SASI_Hs02_00346287 predicted 2407
11 SASI_Hs01_00152037 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233875 predicted 2940
2 SASI_Rn02_00233876 predicted 963
3 SASI_Rn02_00233877 predicted 1586
4 SASI_Rn02_00233878 predicted 1047
5 SASI_Rn02_00233879 predicted 2448
6 SASI_Rn02_00233880 predicted 703
7 SASI_Rn02_00233881 predicted 2253
8 SASI_Rn02_00233882 predicted 926
9 SASI_Rn02_00233883 predicted 856
10 SASI_Rn02_00233884 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131283 predicted 1204
2 SASI_Mm02_00350962 predicted 2481
3 SASI_Mm01_00131284 predicted 3064
4 SASI_Mm01_00131286 predicted 993
5 SASI_Mm01_00131287 predicted 358
6 SASI_Mm01_00131288 predicted 3023
7 SASI_Mm01_00131289 predicted 918
8 SASI_Mm01_00131290 predicted 671
9 SASI_Mm01_00131291 predicted 933
10 SASI_Mm02_00350963 predicted 804
11 SASI_Mm01_00131282 predicted 2981
12 SASI_Mm01_00131285 predicted 660
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198412
DNAJC6 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198412.2-804s21c1
Sequence:CCGGGTGCGACCTACTTGCAGATAACTCGAGTTATCTGCAAGTAGGTCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198412.2-361s21c1
Sequence:CCGGTACGTCACCTCCAGGATTATCCTCGAGGATAATCCTGGAGGTGACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198412.2-3253s21c1
Sequence:CCGGATGATAATGGGATTGCGTAATCTCGAGATTACGCAATCCCATTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198412.2-1229s21c1
Sequence:CCGGTCCAAGTGACACTGGATATAGCTCGAGCTATATCCAGTGTCACTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198412.1-475s1c1
Sequence:CCGGCCTGTGGATAGTGTTGACATACTCGAGTATGTCAACACTATCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198412.1-1099s1c1
Sequence:CCGGCCTCTGAACATCACAGTCCAACTCGAGTTGGACTGTGATGTTCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198412.1-2637s1c1
Sequence:CCGGGCCTCGAACAATAGCTGAGATCTCGAGATCTCAGCTATTGTTCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198412.1-1209s1c1
Sequence:CCGGCCAGTTTCATTCTGGGTTTATCTCGAGATAAACCCAGAATGAAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198412.1-3755s1c1
Sequence:CCGGCCACCATAATTCCAAACCTATCTCGAGATAGGTTTGGAATTATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198412
DNAJC6 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198412.2-804s21c1
Sequence:CCGGGTGCGACCTACTTGCAGATAACTCGAGTTATCTGCAAGTAGGTCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198412.2-361s21c1
Sequence:CCGGTACGTCACCTCCAGGATTATCCTCGAGGATAATCCTGGAGGTGACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198412.2-3253s21c1
Sequence:CCGGATGATAATGGGATTGCGTAATCTCGAGATTACGCAATCCCATTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198412.2-1229s21c1
Sequence:CCGGTCCAAGTGACACTGGATATAGCTCGAGCTATATCCAGTGTCACTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198412.1-475s1c1
Sequence:CCGGCCTGTGGATAGTGTTGACATACTCGAGTATGTCAACACTATCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198412.1-1099s1c1
Sequence:CCGGCCTCTGAACATCACAGTCCAACTCGAGTTGGACTGTGATGTTCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198412.1-2637s1c1
Sequence:CCGGGCCTCGAACAATAGCTGAGATCTCGAGATCTCAGCTATTGTTCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198412.1-1209s1c1
Sequence:CCGGCCAGTTTCATTCTGGGTTTATCTCGAGATAAACCCAGAATGAAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198412.1-3755s1c1
Sequence:CCGGCCACCATAATTCCAAACCTATCTCGAGATAGGTTTGGAATTATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198412
DNAJC6 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198412.2-804s21c1
Sequence:CCGGGTGCGACCTACTTGCAGATAACTCGAGTTATCTGCAAGTAGGTCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198412.2-361s21c1
Sequence:CCGGTACGTCACCTCCAGGATTATCCTCGAGGATAATCCTGGAGGTGACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198412.2-3253s21c1
Sequence:CCGGATGATAATGGGATTGCGTAATCTCGAGATTACGCAATCCCATTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198412.2-1229s21c1
Sequence:CCGGTCCAAGTGACACTGGATATAGCTCGAGCTATATCCAGTGTCACTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198412.1-475s1c1
Sequence:CCGGCCTGTGGATAGTGTTGACATACTCGAGTATGTCAACACTATCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198412.1-1099s1c1
Sequence:CCGGCCTCTGAACATCACAGTCCAACTCGAGTTGGACTGTGATGTTCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198412.1-2637s1c1
Sequence:CCGGGCCTCGAACAATAGCTGAGATCTCGAGATCTCAGCTATTGTTCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198412.1-1209s1c1
Sequence:CCGGCCAGTTTCATTCTGGGTTTATCTCGAGATAAACCCAGAATGAAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198412.1-3755s1c1
Sequence:CCGGCCACCATAATTCCAAACCTATCTCGAGATAGGTTTGGAATTATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014787
VALIDATED
DNAJC6 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014787.2-851s21c1
Sequence:CCGGGCCTCTCACAATTAAGTCGATCTCGAGATCGACTTAATTGTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014787.2-2460s21c1
Sequence:CCGGCGTGGGAAAGGATCAAGTAATCTCGAGATTACTTGATCCTTTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014787.2-334s21c1
Sequence:CCGGCCAGCTACACAAAGGGAGATTCTCGAGAATCTCCCTTTGTGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014787.2-3246s21c1
Sequence:CCGGTTGTCTGAGAATAGGATTAATCTCGAGATTAATCCTATTCTCAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014787.2-2678s21c1
Sequence:CCGGCACGATGCATACCGTACTATGCTCGAGCATAGTACGGTATGCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014787.2-588s21c1
Sequence:GTACCGGTTTGCTGTGTGTCGGAATATGCTCGAGCATATTCCGACACACAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014787.x-5211s1c1
Sequence:CCGGCCTTCTGACATGATTTACTTTCTCGAGAAAGTAAATCATGTCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014787.x-355s1c1
Sequence:CCGGCACTTATGTTACCTCCAGAATCTCGAGATTCTGGAGGTAACATAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014787.x-327s1c1
Sequence:CCGGCCAGCTACACAAAGGGAGATTCTCGAGAATCTCCCTTTGTGTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014787.x-844s1c1
Sequence:CCGGGCCTCTCACAATTAAGTCGATCTCGAGATCGACTTAATTGTGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014787.x-2453s1c1
Sequence:CCGGCGTGGGAAAGGATCAAGTAATCTCGAGATTACTTGATCCTTTCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014787
VALIDATED
DNAJC6 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014787.2-851s21c1
Sequence:CCGGGCCTCTCACAATTAAGTCGATCTCGAGATCGACTTAATTGTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014787.2-2460s21c1
Sequence:CCGGCGTGGGAAAGGATCAAGTAATCTCGAGATTACTTGATCCTTTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014787.2-334s21c1
Sequence:CCGGCCAGCTACACAAAGGGAGATTCTCGAGAATCTCCCTTTGTGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014787.2-3246s21c1
Sequence:CCGGTTGTCTGAGAATAGGATTAATCTCGAGATTAATCCTATTCTCAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014787.2-2678s21c1
Sequence:CCGGCACGATGCATACCGTACTATGCTCGAGCATAGTACGGTATGCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014787.2-588s21c1
Sequence:GTACCGGTTTGCTGTGTGTCGGAATATGCTCGAGCATATTCCGACACACAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014787.x-5211s1c1
Sequence:CCGGCCTTCTGACATGATTTACTTTCTCGAGAAAGTAAATCATGTCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014787.x-355s1c1
Sequence:CCGGCACTTATGTTACCTCCAGAATCTCGAGATTCTGGAGGTAACATAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014787.x-327s1c1
Sequence:CCGGCCAGCTACACAAAGGGAGATTCTCGAGAATCTCCCTTTGTGTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014787.x-844s1c1
Sequence:CCGGGCCTCTCACAATTAAGTCGATCTCGAGATCGACTTAATTGTGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014787.x-2453s1c1
Sequence:CCGGCGTGGGAAAGGATCAAGTAATCTCGAGATTACTTGATCCTTTCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014787
VALIDATED
DNAJC6 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014787.2-851s21c1
Sequence:CCGGGCCTCTCACAATTAAGTCGATCTCGAGATCGACTTAATTGTGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014787.2-2460s21c1
Sequence:CCGGCGTGGGAAAGGATCAAGTAATCTCGAGATTACTTGATCCTTTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014787.2-334s21c1
Sequence:CCGGCCAGCTACACAAAGGGAGATTCTCGAGAATCTCCCTTTGTGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014787.2-3246s21c1
Sequence:CCGGTTGTCTGAGAATAGGATTAATCTCGAGATTAATCCTATTCTCAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014787.2-2678s21c1
Sequence:CCGGCACGATGCATACCGTACTATGCTCGAGCATAGTACGGTATGCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014787.2-588s21c1
Sequence:GTACCGGTTTGCTGTGTGTCGGAATATGCTCGAGCATATTCCGACACACAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014787.x-5211s1c1
Sequence:CCGGCCTTCTGACATGATTTACTTTCTCGAGAAAGTAAATCATGTCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014787.x-355s1c1
Sequence:CCGGCACTTATGTTACCTCCAGAATCTCGAGATTCTGGAGGTAACATAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014787.x-327s1c1
Sequence:CCGGCCAGCTACACAAAGGGAGATTCTCGAGAATCTCCCTTTGTGTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014787.x-844s1c1
Sequence:CCGGGCCTCTCACAATTAAGTCGATCTCGAGATCGACTTAATTGTGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014787.x-2453s1c1
Sequence:CCGGCGTGGGAAAGGATCAAGTAATCTCGAGATTACTTGATCCTTTCCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks