EMAIL THIS PAGE TO A FRIEND

DNAJC7

DnaJ (Hsp40) homolog, subfamily C, member 7

77 Gene Product Result for
Synonyms: DJ11 DJC7 TPR2 TTC2
UniProtKB ID: Q99615, Q7Z784
Gene ID:
Human(7266) Summary: This gene encodes a member of the DNAJ heat shock protein 40 family of proteins that is characterized by two N-terminal tetratricopeptide repeat domains and a C-terminal DNAJ domain. This protein binds the chaperone proteins heat shock proteins 70 and 90 in an ATP-dependent manner and may function as a co-chaperone. Pseudogenes of this gene are found on chromosomes 1 and 6. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Mouse(56354) DnaJ (Hsp40) homolog, subfamily C, member 7
Rat(303536) DnaJ (Hsp40) homolog, subfamily C, member 7
sheep(101120677) DnaJ (Hsp40) homolog, subfamily C, member 7
Domestic Rabbit(100347008) DnaJ (Hsp40) homolog, subfamily C, member 7
naked mole-rat(101698683) DnaJ (Hsp40) homolog, subfamily C, member 7
domestic guinea pig(100715399) DnaJ (Hsp40) homolog, subfamily C, member 7
Zebrafish(406579) DnaJ (Hsp40) homolog, subfamily C, member 7
domestic cat(101093473) DnaJ (Hsp40) homolog, subfamily C, member 7
Horse(100053144) DnaJ (Hsp40) homolog, subfamily C, member 7
cow(530254) DnaJ (Hsp40) homolog, subfamily C, member 7
dog(480519) DnaJ (Hsp40) homolog, subfamily C, member 7
chicken(428312) DnaJ (Hsp40) homolog, subfamily C, member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003315 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003315 Rosetta Predictions human pricing
NM_213625 Rosetta Predictions rat pricing
NM_019795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073702 predicted 1295
2 SASI_Hs01_00073703 predicted 944
3 SASI_Hs02_00335438 predicted 1008
4 SASI_Hs01_00073704 predicted 585
5 SASI_Hs01_00073706 predicted 1282
6 SASI_Hs01_00073707 predicted 622
7 SASI_Hs01_00073708 predicted 1208
8 SASI_Hs01_00073709 predicted 777
9 SASI_Hs01_00073711 predicted 998
10 SASI_Hs02_00335439 predicted 593
11 SASI_Hs01_00073705 predicted 416
12 SASI_Hs01_00073710 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213625 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035865 predicted 819
2 SASI_Rn01_00035867 predicted 462
3 SASI_Rn01_00035868 predicted 804
4 SASI_Rn01_00035869 predicted 937
5 SASI_Rn01_00035870 predicted 1079
6 SASI_Rn01_00035871 predicted 783
7 SASI_Rn01_00035872 predicted 842
8 SASI_Rn01_00035873 predicted 796
9 SASI_Rn01_00035874 predicted 902
10 SASI_Rn02_00270616 predicted 923
11 SASI_Rn01_00035866 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086772 predicted 1027
2 SASI_Mm01_00086773 predicted 703
3 SASI_Mm01_00086775 predicted 658
4 SASI_Mm01_00086776 predicted 2019
5 SASI_Mm01_00086777 predicted 727
6 SASI_Mm01_00086778 predicted 1647
7 SASI_Mm01_00086779 predicted 1896
8 SASI_Mm01_00086780 predicted 2036
9 SASI_Mm01_00086781 predicted 1500
10 SASI_Mm02_00325021 predicted 1346
11 SASI_Mm01_00086774 predicted 1375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019795
VALIDATED
DNAJC7 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019795.3-984s1c1
Sequence:CCGGGCCGTCATGGAGTATGAGAAACTCGAGTTTCTCATACTCCATGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019795.3-681s1c1
Sequence:CCGGGCTAAGAAGGACTACAACGAACTCGAGTTCGTTGTAGTCCTTCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019795.3-1833s1c1
Sequence:CCGGGAGGAGAAGAAGTTTAAGGAACTCGAGTTCCTTAAACTTCTTCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019795.3-2134s1c1
Sequence:CCGGCCTGTGTACTTAGAGCAGTTTCTCGAGAAACTGCTCTAAGTACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019795.3-1500s1c1
Sequence:CCGGGCCATAGAAGACTGTACAAATCTCGAGATTTGTACAGTCTTCTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019795.4-985s21c1
Sequence:CCGGGCCGTCATGGAGTATGAGAAACTCGAGTTTCTCATACTCCATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019795.4-1834s21c1
Sequence:CCGGGAGGAGAAGAAGTTTAAGGAACTCGAGTTCCTTAAACTTCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019795.4-1501s21c1
Sequence:CCGGGCCATAGAAGACTGTACAAATCTCGAGATTTGTACAGTCTTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019795.4-2135s21c1
Sequence:CCGGCCTGTGTACTTAGAGCAGTTTCTCGAGAAACTGCTCTAAGTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019795.4-682s21c1
Sequence:CCGGGCTAAGAAGGACTACAACGAACTCGAGTTCGTTGTAGTCCTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019795
VALIDATED
DNAJC7 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019795.3-984s1c1
Sequence:CCGGGCCGTCATGGAGTATGAGAAACTCGAGTTTCTCATACTCCATGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019795.3-681s1c1
Sequence:CCGGGCTAAGAAGGACTACAACGAACTCGAGTTCGTTGTAGTCCTTCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019795.3-1833s1c1
Sequence:CCGGGAGGAGAAGAAGTTTAAGGAACTCGAGTTCCTTAAACTTCTTCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019795.3-2134s1c1
Sequence:CCGGCCTGTGTACTTAGAGCAGTTTCTCGAGAAACTGCTCTAAGTACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019795.3-1500s1c1
Sequence:CCGGGCCATAGAAGACTGTACAAATCTCGAGATTTGTACAGTCTTCTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019795.4-985s21c1
Sequence:CCGGGCCGTCATGGAGTATGAGAAACTCGAGTTTCTCATACTCCATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019795.4-1834s21c1
Sequence:CCGGGAGGAGAAGAAGTTTAAGGAACTCGAGTTCCTTAAACTTCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019795.4-1501s21c1
Sequence:CCGGGCCATAGAAGACTGTACAAATCTCGAGATTTGTACAGTCTTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019795.4-2135s21c1
Sequence:CCGGCCTGTGTACTTAGAGCAGTTTCTCGAGAAACTGCTCTAAGTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019795.4-682s21c1
Sequence:CCGGGCTAAGAAGGACTACAACGAACTCGAGTTCGTTGTAGTCCTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019795
VALIDATED
DNAJC7 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019795.3-984s1c1
Sequence:CCGGGCCGTCATGGAGTATGAGAAACTCGAGTTTCTCATACTCCATGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019795.3-681s1c1
Sequence:CCGGGCTAAGAAGGACTACAACGAACTCGAGTTCGTTGTAGTCCTTCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019795.3-1833s1c1
Sequence:CCGGGAGGAGAAGAAGTTTAAGGAACTCGAGTTCCTTAAACTTCTTCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019795.3-2134s1c1
Sequence:CCGGCCTGTGTACTTAGAGCAGTTTCTCGAGAAACTGCTCTAAGTACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019795.3-1500s1c1
Sequence:CCGGGCCATAGAAGACTGTACAAATCTCGAGATTTGTACAGTCTTCTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019795.4-985s21c1
Sequence:CCGGGCCGTCATGGAGTATGAGAAACTCGAGTTTCTCATACTCCATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019795.4-1834s21c1
Sequence:CCGGGAGGAGAAGAAGTTTAAGGAACTCGAGTTCCTTAAACTTCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019795.4-1501s21c1
Sequence:CCGGGCCATAGAAGACTGTACAAATCTCGAGATTTGTACAGTCTTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019795.4-2135s21c1
Sequence:CCGGCCTGTGTACTTAGAGCAGTTTCTCGAGAAACTGCTCTAAGTACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019795.4-682s21c1
Sequence:CCGGGCTAAGAAGGACTACAACGAACTCGAGTTCGTTGTAGTCCTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003315
VALIDATED
DNAJC7 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003315.1-630s1c1
Sequence:CCGGGCTCTGTATGTACGAGGTCTTCTCGAGAAGACCTCGTACATACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003315.1-156s1c1
Sequence:CCGGGCCATAGATATGTGTCCTAAACTCGAGTTTAGGACACATATCTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003315.1-1109s1c1
Sequence:CCGGGCTGGAACTGAAGAAGAGTAACTCGAGTTACTCTTCTTCAGTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003315.1-360s1c1
Sequence:CCGGGCCCTAGAACTGGATCATAAACTCGAGTTTATGATCCAGTTCTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003315.1-1573s1c1
Sequence:CCGGTCCGTGTGCTTAGAGCAGTTTCTCGAGAAACTGCTCTAAGCACACGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003315.3-1796s21c1
Sequence:CCGGTGCAGATTCACTCAGTTTAATCTCGAGATTAAACTGAGTGAATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003315.3-774s21c1
Sequence:CCGGATGGACCGTGCCCTAGAATTTCTCGAGAAATTCTAGGGCACGGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003315.3-838s21c1
Sequence:CCGGTAGCAATGCTGGGTCGTTATCCTCGAGGATAACGACCCAGCATTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003315.3-696s21c1
Sequence:CCGGGCTAATGCAGTCATGGAATATCTCGAGATATTCCATGACTGCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003315.3-1203s21c1
Sequence:CCGGAGGAAACTAGATGATGCAATACTCGAGTATTGCATCATCTAGTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003315
VALIDATED
DNAJC7 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003315.1-630s1c1
Sequence:CCGGGCTCTGTATGTACGAGGTCTTCTCGAGAAGACCTCGTACATACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003315.1-156s1c1
Sequence:CCGGGCCATAGATATGTGTCCTAAACTCGAGTTTAGGACACATATCTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003315.1-1109s1c1
Sequence:CCGGGCTGGAACTGAAGAAGAGTAACTCGAGTTACTCTTCTTCAGTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003315.1-360s1c1
Sequence:CCGGGCCCTAGAACTGGATCATAAACTCGAGTTTATGATCCAGTTCTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003315.1-1573s1c1
Sequence:CCGGTCCGTGTGCTTAGAGCAGTTTCTCGAGAAACTGCTCTAAGCACACGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003315.3-1796s21c1
Sequence:CCGGTGCAGATTCACTCAGTTTAATCTCGAGATTAAACTGAGTGAATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003315.3-774s21c1
Sequence:CCGGATGGACCGTGCCCTAGAATTTCTCGAGAAATTCTAGGGCACGGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003315.3-838s21c1
Sequence:CCGGTAGCAATGCTGGGTCGTTATCCTCGAGGATAACGACCCAGCATTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003315.3-696s21c1
Sequence:CCGGGCTAATGCAGTCATGGAATATCTCGAGATATTCCATGACTGCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003315.3-1203s21c1
Sequence:CCGGAGGAAACTAGATGATGCAATACTCGAGTATTGCATCATCTAGTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003315
VALIDATED
DNAJC7 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003315.1-630s1c1
Sequence:CCGGGCTCTGTATGTACGAGGTCTTCTCGAGAAGACCTCGTACATACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003315.1-156s1c1
Sequence:CCGGGCCATAGATATGTGTCCTAAACTCGAGTTTAGGACACATATCTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003315.1-1109s1c1
Sequence:CCGGGCTGGAACTGAAGAAGAGTAACTCGAGTTACTCTTCTTCAGTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003315.1-360s1c1
Sequence:CCGGGCCCTAGAACTGGATCATAAACTCGAGTTTATGATCCAGTTCTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003315.1-1573s1c1
Sequence:CCGGTCCGTGTGCTTAGAGCAGTTTCTCGAGAAACTGCTCTAAGCACACGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003315.3-1796s21c1
Sequence:CCGGTGCAGATTCACTCAGTTTAATCTCGAGATTAAACTGAGTGAATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003315.3-774s21c1
Sequence:CCGGATGGACCGTGCCCTAGAATTTCTCGAGAAATTCTAGGGCACGGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003315.3-838s21c1
Sequence:CCGGTAGCAATGCTGGGTCGTTATCCTCGAGGATAACGACCCAGCATTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003315.3-696s21c1
Sequence:CCGGGCTAATGCAGTCATGGAATATCTCGAGATATTCCATGACTGCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003315.3-1203s21c1
Sequence:CCGGAGGAAACTAGATGATGCAATACTCGAGTATTGCATCATCTAGTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks