EMAIL THIS PAGE TO A FRIEND

DNAJC8

DnaJ (Hsp40) homolog, subfamily C, member 8

125 Gene Product Result for
Synonyms: HSPC331 SPF31
Gene ID:
Mouse(68598) DnaJ (Hsp40) homolog, subfamily C, member 8
Rat(313035) DnaJ (Hsp40) homolog, subfamily C, member 8
Zebrafish(724001) DnaJ (Hsp40) homolog, subfamily C, member 8
cow(614259) DnaJ (Hsp40) homolog, subfamily C, member 8
domestic cat(101086161) DnaJ (Hsp40) homolog, subfamily C, member 8
dog(478166) DnaJ (Hsp40) homolog, subfamily C, member 8
chicken(419569) DnaJ (Hsp40) homolog, subfamily C, member 8
domestic guinea pig(100720434) DnaJ (Hsp40) homolog, subfamily C, member 8
naked mole-rat(101713118) DnaJ (Hsp40) homolog, subfamily C, member 8
sheep(101104209) DnaJ (Hsp40) homolog, subfamily C, member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172400 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172400 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172400 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014280 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014280 Rosetta Predictions human pricing
NM_001013168 Rosetta Predictions rat pricing
NM_172400 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188631 predicted 883
2 SASI_Hs01_00188633 predicted 494
3 SASI_Hs01_00188634 predicted 211
4 SASI_Hs01_00188635 predicted 521
5 SASI_Hs01_00188636 predicted 450
6 SASI_Hs01_00188637 predicted 341
7 SASI_Hs01_00188638 predicted 273
8 SASI_Hs01_00188639 predicted 197
9 SASI_Hs02_00345355 predicted 529
10 SASI_Hs01_00188640 predicted 1021
11 SASI_Hs01_00188632 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120535 predicted 1102
2 SASI_Rn01_00120536 predicted 923
3 SASI_Rn01_00120537 predicted 284
4 SASI_Rn02_00200910 predicted 864
5 SASI_Rn01_00120541 predicted 924
6 SASI_Rn01_00120542 predicted 1094
7 SASI_Rn01_00120543 predicted 1096
8 SASI_Rn01_00120544 predicted 921
9 SASI_Rn02_00200911 predicted 1162
10 SASI_Rn02_00200912 predicted 975
11 SASI_Rn01_00120538 predicted 1075
12 SASI_Rn01_00120539 predicted 1109
13 SASI_Rn01_00120540 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148060 predicted 917
2 SASI_Mm02_00343853 predicted 917
3 SASI_Mm01_00148061 predicted 915
4 SASI_Mm01_00148062 predicted 349
5 SASI_Mm01_00148063 predicted 336
6 SASI_Mm01_00148064 predicted 1094
7 SASI_Mm01_00148065 predicted 386
8 SASI_Mm01_00148066 predicted 206
9 SASI_Mm01_00148067 predicted 523
10 SASI_Mm02_00343854 predicted 384
11 SASI_Mm01_00148068 predicted 675
12 SASI_Mm01_00148069 predicted 204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172400
VALIDATED
DNAJC8 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 8
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172400.3-860s21c1
Sequence:CCGGCCAGAGAGTAGCGATTGCTTTCTCGAGAAAGCAATCGCTACTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172400.3-1029s21c1
Sequence:CCGGCCACGCCTCTAACTTAATGTTCTCGAGAACATTAAGTTAGAGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172400.3-495s21c1
Sequence:CCGGACTGTTCAAACAGGCAGTCTACTCGAGTAGACTGCCTGTTTGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172400.1-1032s1c1
Sequence:CCGGCCACGCCTCTAACTTAATGTTCTCGAGAACATTAAGTTAGAGGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172400.1-687s1c1
Sequence:CCGGGAGTGGACAGTTGGCGAAATTCTCGAGAATTTCGCCAACTGTCCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172400.1-499s1c1
Sequence:CCGGACTGTTCAAACAGGCAGTCTACTCGAGTAGACTGCCTGTTTGAACAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172400.1-424s1c1
Sequence:CCGGACACACTGTTAAAGAGCGAAACTCGAGTTTCGCTCTTTAACAGTGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172400.1-863s1c1
Sequence:CCGGCCAGAGAGTAGCGATTGCTTTCTCGAGAAAGCAATCGCTACTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172400
VALIDATED
DNAJC8 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 8
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172400.3-860s21c1
Sequence:CCGGCCAGAGAGTAGCGATTGCTTTCTCGAGAAAGCAATCGCTACTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172400.3-1029s21c1
Sequence:CCGGCCACGCCTCTAACTTAATGTTCTCGAGAACATTAAGTTAGAGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172400.3-495s21c1
Sequence:CCGGACTGTTCAAACAGGCAGTCTACTCGAGTAGACTGCCTGTTTGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172400.1-1032s1c1
Sequence:CCGGCCACGCCTCTAACTTAATGTTCTCGAGAACATTAAGTTAGAGGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172400.1-687s1c1
Sequence:CCGGGAGTGGACAGTTGGCGAAATTCTCGAGAATTTCGCCAACTGTCCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172400.1-499s1c1
Sequence:CCGGACTGTTCAAACAGGCAGTCTACTCGAGTAGACTGCCTGTTTGAACAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172400.1-424s1c1
Sequence:CCGGACACACTGTTAAAGAGCGAAACTCGAGTTTCGCTCTTTAACAGTGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172400.1-863s1c1
Sequence:CCGGCCAGAGAGTAGCGATTGCTTTCTCGAGAAAGCAATCGCTACTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172400
VALIDATED
DNAJC8 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 8
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172400.3-860s21c1
Sequence:CCGGCCAGAGAGTAGCGATTGCTTTCTCGAGAAAGCAATCGCTACTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172400.3-1029s21c1
Sequence:CCGGCCACGCCTCTAACTTAATGTTCTCGAGAACATTAAGTTAGAGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172400.3-495s21c1
Sequence:CCGGACTGTTCAAACAGGCAGTCTACTCGAGTAGACTGCCTGTTTGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172400.1-1032s1c1
Sequence:CCGGCCACGCCTCTAACTTAATGTTCTCGAGAACATTAAGTTAGAGGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172400.1-687s1c1
Sequence:CCGGGAGTGGACAGTTGGCGAAATTCTCGAGAATTTCGCCAACTGTCCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172400.1-499s1c1
Sequence:CCGGACTGTTCAAACAGGCAGTCTACTCGAGTAGACTGCCTGTTTGAACAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172400.1-424s1c1
Sequence:CCGGACACACTGTTAAAGAGCGAAACTCGAGTTTCGCTCTTTAACAGTGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172400.1-863s1c1
Sequence:CCGGCCAGAGAGTAGCGATTGCTTTCTCGAGAAAGCAATCGCTACTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014280
DNAJC8 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 8
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000022284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014280.1-852s1c1
Sequence:CCGGGCTTCGAAGGACTCATTCTTTCTCGAGAAAGAATGAGTCCTTCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014280.1-479s1c1
Sequence:CCGGCCTACAATTGTAGAGGAGGATCTCGAGATCCTCCTCTACAATTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014280.1-508s1c1
Sequence:CCGGGCTGTTCAAACAAGCTGTATACTCGAGTATACAGCTTGTTTGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014280.1-356s1c1
Sequence:CCGGGCTTACAAGTTGCTACTGGATCTCGAGATCCAGTAGCAACTTGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014280
DNAJC8 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 8
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000022284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014280.1-852s1c1
Sequence:CCGGGCTTCGAAGGACTCATTCTTTCTCGAGAAAGAATGAGTCCTTCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014280.1-479s1c1
Sequence:CCGGCCTACAATTGTAGAGGAGGATCTCGAGATCCTCCTCTACAATTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014280.1-508s1c1
Sequence:CCGGGCTGTTCAAACAAGCTGTATACTCGAGTATACAGCTTGTTTGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014280.1-356s1c1
Sequence:CCGGGCTTACAAGTTGCTACTGGATCTCGAGATCCAGTAGCAACTTGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014280
DNAJC8 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 8
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000022284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014280.1-852s1c1
Sequence:CCGGGCTTCGAAGGACTCATTCTTTCTCGAGAAAGAATGAGTCCTTCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014280.1-479s1c1
Sequence:CCGGCCTACAATTGTAGAGGAGGATCTCGAGATCCTCCTCTACAATTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014280.1-508s1c1
Sequence:CCGGGCTGTTCAAACAAGCTGTATACTCGAGTATACAGCTTGTTTGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014280.1-356s1c1
Sequence:CCGGGCTTACAAGTTGCTACTGGATCTCGAGATCCAGTAGCAACTTGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks