EMAIL THIS PAGE TO A FRIEND

DNAJC9

DnaJ (Hsp40) homolog, subfamily C, member 9

53 Gene Product Result for
Synonyms: HDJC9 JDD1 SB73
UniProtKB ID: Q8WXX5
Gene ID:
Mouse(108671) DnaJ (Hsp40) homolog, subfamily C, member 9
Rat(364240) DnaJ (Hsp40) homolog, subfamily C, member 9
Zebrafish(436706) DnaJ (Hsp40) homolog, subfamily C, member 9
chicken(423640) DnaJ (Hsp40) homolog, subfamily C, member 9
dog(489047) DnaJ (Hsp40) homolog, subfamily C, member 9
cow(510898) DnaJ (Hsp40) homolog, subfamily C, member 9
domestic cat(101085154) DnaJ (Hsp40) homolog, subfamily C, member 9
sheep(101117902) DnaJ (Hsp40) homolog, subfamily C, member 9
naked mole-rat(101706232) DnaJ (Hsp40) homolog, subfamily C, member 9
domestic guinea pig(100717852) DnaJ (Hsp40) homolog, subfamily C, member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134081 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134081 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134081 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015190 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015190 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015190 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015190 Rosetta Predictions human pricing
NM_001108865 Rosetta Predictions rat pricing
NM_134081 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173346 predicted 553
2 SASI_Hs01_00173347 predicted 938
3 SASI_Hs01_00173348 predicted 958
4 SASI_Hs01_00173349 predicted 792
5 SASI_Hs01_00173350 predicted 366
6 SASI_Hs01_00173352 predicted 452
7 SASI_Hs01_00173353 predicted 424
8 SASI_Hs01_00173354 predicted 590
9 SASI_Hs02_00347257 predicted 667
10 SASI_Hs02_00347258 predicted 604
11 SASI_Hs01_00173351 predicted 879
12 SASI_Hs01_00173355 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242845 predicted 558
2 SASI_Rn02_00242846 predicted 628
3 SASI_Rn02_00242847 predicted 381
4 SASI_Rn02_00242848 predicted 607
5 SASI_Rn02_00242849 predicted 455
6 SASI_Rn02_00242850 predicted 928
7 SASI_Rn02_00242851 predicted 416
8 SASI_Rn02_00242852 predicted 450
9 SASI_Rn02_00242853 predicted 638
10 SASI_Rn02_00242854 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038704 predicted 389
2 SASI_Mm02_00339302 predicted 628
3 SASI_Mm01_00038705 predicted 567
4 SASI_Mm01_00038708 predicted 444
5 SASI_Mm01_00038709 predicted 461
6 SASI_Mm02_00339303 predicted 458
7 SASI_Mm02_00339304 predicted 317
8 SASI_Mm01_00038711 predicted 683
9 SASI_Mm02_00339305 predicted 268
10 SASI_Mm02_00339306 predicted 556
11 SASI_Mm01_00038702 predicted 1032
12 SASI_Mm01_00038703 predicted 1119
13 SASI_Mm01_00038706 predicted 1007
14 SASI_Mm01_00038707 predicted 893
15 SASI_Mm01_00038710 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134081
VALIDATED
DNAJC9 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115461    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134081.2-1405s1c1
Sequence:CCGGCCATTGGTCTATGAAGATAAACTCGAGTTTATCTTCATAGACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134081.2-626s1c1
Sequence:CCGGGCCTTCGTCAAAGAGTCTAAACTCGAGTTTAGACTCTTTGACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134081.2-302s1c1
Sequence:CCGGCTGAGTGACAAGGAACAGAAACTCGAGTTTCTGTTCCTTGTCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134081.2-593s1c1
Sequence:CCGGGCTATTGAATCCAAAGAGATTCTCGAGAATCTCTTTGGATTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134081.2-465s1c1
Sequence:CCGGCCGAAGAAGAGCTAAACGATACTCGAGTATCGTTTAGCTCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134081.4-626s21c1
Sequence:CCGGGCCTTCGTCAAAGAGTCTAAACTCGAGTTTAGACTCTTTGACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134081.4-593s21c1
Sequence:CCGGGCTATTGAATCCAAAGAGATTCTCGAGAATCTCTTTGGATTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134081.4-302s21c1
Sequence:CCGGCTGAGTGACAAGGAACAGAAACTCGAGTTTCTGTTCCTTGTCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134081.4-465s21c1
Sequence:CCGGCCGAAGAAGAGCTAAACGATACTCGAGTATCGTTTAGCTCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134081
VALIDATED
DNAJC9 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115461    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134081.2-1405s1c1
Sequence:CCGGCCATTGGTCTATGAAGATAAACTCGAGTTTATCTTCATAGACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134081.2-626s1c1
Sequence:CCGGGCCTTCGTCAAAGAGTCTAAACTCGAGTTTAGACTCTTTGACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134081.2-302s1c1
Sequence:CCGGCTGAGTGACAAGGAACAGAAACTCGAGTTTCTGTTCCTTGTCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134081.2-593s1c1
Sequence:CCGGGCTATTGAATCCAAAGAGATTCTCGAGAATCTCTTTGGATTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134081.2-465s1c1
Sequence:CCGGCCGAAGAAGAGCTAAACGATACTCGAGTATCGTTTAGCTCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134081.4-626s21c1
Sequence:CCGGGCCTTCGTCAAAGAGTCTAAACTCGAGTTTAGACTCTTTGACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134081.4-593s21c1
Sequence:CCGGGCTATTGAATCCAAAGAGATTCTCGAGAATCTCTTTGGATTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134081.4-302s21c1
Sequence:CCGGCTGAGTGACAAGGAACAGAAACTCGAGTTTCTGTTCCTTGTCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134081.4-465s21c1
Sequence:CCGGCCGAAGAAGAGCTAAACGATACTCGAGTATCGTTTAGCTCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134081
VALIDATED
DNAJC9 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115461    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134081.2-1405s1c1
Sequence:CCGGCCATTGGTCTATGAAGATAAACTCGAGTTTATCTTCATAGACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134081.2-626s1c1
Sequence:CCGGGCCTTCGTCAAAGAGTCTAAACTCGAGTTTAGACTCTTTGACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134081.2-302s1c1
Sequence:CCGGCTGAGTGACAAGGAACAGAAACTCGAGTTTCTGTTCCTTGTCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134081.2-593s1c1
Sequence:CCGGGCTATTGAATCCAAAGAGATTCTCGAGAATCTCTTTGGATTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134081.2-465s1c1
Sequence:CCGGCCGAAGAAGAGCTAAACGATACTCGAGTATCGTTTAGCTCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134081.4-626s21c1
Sequence:CCGGGCCTTCGTCAAAGAGTCTAAACTCGAGTTTAGACTCTTTGACGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134081.4-593s21c1
Sequence:CCGGGCTATTGAATCCAAAGAGATTCTCGAGAATCTCTTTGGATTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134081.4-302s21c1
Sequence:CCGGCTGAGTGACAAGGAACAGAAACTCGAGTTTCTGTTCCTTGTCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134081.4-465s21c1
Sequence:CCGGCCGAAGAAGAGCTAAACGATACTCGAGTATCGTTTAGCTCTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015190
VALIDATED
DNAJC9 MISSION shRNA Bacterial Glycerol Stock
DnaJ (Hsp40) homolog, subfamily C, member 9
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-291s1c1
Sequence:CCGGCAGAGAACAGAGAGCAGTGTACTCGAGTACACTGCTCTCTGTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165867    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015190.3-919s1c1
Sequence:CCGGGCAGGCAAGATTTGAAGGCAACTCGAGTTGCCTTCAAATCTTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-592s1c1
Sequence:CCGGGTCCCATCCTATAATGCCTTTCTCGAGAAAGGCATTATAGGATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-460s1c1
Sequence:CCGGGCTGATATTAAGCAGGCCTATCTCGAGATAGGCCTGCTTAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-558s1c1
Sequence:CCGGGAATATCATTCAGCAAGCTATCTCGAGATAGCTTGCTGAATGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-607s1c1
Sequence:CCGGGCCTTTGTCAAAGAATCGAAACTCGAGTTTCGATTCTTTGACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-1285s1c1
Sequence:CCGGCCCAGTTTACATTTGGTCTTACTCGAGTAAGACCAAATGTAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-789s1c1
Sequence:CCGGGATGGAAGCAAAGTACTGCAACTCGAGTTGCAGTACTTTGCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-489s1c1
Sequence:CCGGCAAGGGTGACATGGATCAGATCTCGAGATCTGATCCATGTCACCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-731s1c1
Sequence:CCGGCAGCCATTCAGAGCAGACAAACTCGAGTTTGTCTGCTCTGAATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015190.3-731s21c1
Sequence:CCGGCAGCCATTCAGAGCAGACAAACTCGAGTTTGTCTGCTCTGAATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015190.3-1015s21c1
Sequence:CCGGTCAACCTGATCTTAGTATTTCCTCGAGGAAATACTAAGATCAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015190.3-592s21c1
Sequence:CCGGGTCCCATCCTATAATGCCTTTCTCGAGAAAGGCATTATAGGATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015190.3-489s21c1
Sequence:CCGGCAAGGGTGACATGGATCAGATCTCGAGATCTGATCCATGTCACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015190.3-607s21c1
Sequence:CCGGGCCTTTGTCAAAGAATCGAAACTCGAGTTTCGATTCTTTGACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015190
VALIDATED
DNAJC9 MISSION shRNA shRNA Plasmid DNA
DnaJ (Hsp40) homolog, subfamily C, member 9
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-291s1c1
Sequence:CCGGCAGAGAACAGAGAGCAGTGTACTCGAGTACACTGCTCTCTGTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165867    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015190.3-919s1c1
Sequence:CCGGGCAGGCAAGATTTGAAGGCAACTCGAGTTGCCTTCAAATCTTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-592s1c1
Sequence:CCGGGTCCCATCCTATAATGCCTTTCTCGAGAAAGGCATTATAGGATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-460s1c1
Sequence:CCGGGCTGATATTAAGCAGGCCTATCTCGAGATAGGCCTGCTTAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-558s1c1
Sequence:CCGGGAATATCATTCAGCAAGCTATCTCGAGATAGCTTGCTGAATGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-607s1c1
Sequence:CCGGGCCTTTGTCAAAGAATCGAAACTCGAGTTTCGATTCTTTGACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-1285s1c1
Sequence:CCGGCCCAGTTTACATTTGGTCTTACTCGAGTAAGACCAAATGTAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-789s1c1
Sequence:CCGGGATGGAAGCAAAGTACTGCAACTCGAGTTGCAGTACTTTGCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-489s1c1
Sequence:CCGGCAAGGGTGACATGGATCAGATCTCGAGATCTGATCCATGTCACCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-731s1c1
Sequence:CCGGCAGCCATTCAGAGCAGACAAACTCGAGTTTGTCTGCTCTGAATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015190.3-731s21c1
Sequence:CCGGCAGCCATTCAGAGCAGACAAACTCGAGTTTGTCTGCTCTGAATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015190.3-1015s21c1
Sequence:CCGGTCAACCTGATCTTAGTATTTCCTCGAGGAAATACTAAGATCAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015190.3-592s21c1
Sequence:CCGGGTCCCATCCTATAATGCCTTTCTCGAGAAAGGCATTATAGGATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015190.3-489s21c1
Sequence:CCGGCAAGGGTGACATGGATCAGATCTCGAGATCTGATCCATGTCACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015190.3-607s21c1
Sequence:CCGGGCCTTTGTCAAAGAATCGAAACTCGAGTTTCGATTCTTTGACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015190
VALIDATED
DNAJC9 MISSION shRNA Lentiviral Transduction Particles
DnaJ (Hsp40) homolog, subfamily C, member 9
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-291s1c1
Sequence:CCGGCAGAGAACAGAGAGCAGTGTACTCGAGTACACTGCTCTCTGTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165867    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015190.3-919s1c1
Sequence:CCGGGCAGGCAAGATTTGAAGGCAACTCGAGTTGCCTTCAAATCTTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-592s1c1
Sequence:CCGGGTCCCATCCTATAATGCCTTTCTCGAGAAAGGCATTATAGGATGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-460s1c1
Sequence:CCGGGCTGATATTAAGCAGGCCTATCTCGAGATAGGCCTGCTTAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-558s1c1
Sequence:CCGGGAATATCATTCAGCAAGCTATCTCGAGATAGCTTGCTGAATGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-607s1c1
Sequence:CCGGGCCTTTGTCAAAGAATCGAAACTCGAGTTTCGATTCTTTGACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-1285s1c1
Sequence:CCGGCCCAGTTTACATTTGGTCTTACTCGAGTAAGACCAAATGTAAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-789s1c1
Sequence:CCGGGATGGAAGCAAAGTACTGCAACTCGAGTTGCAGTACTTTGCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-489s1c1
Sequence:CCGGCAAGGGTGACATGGATCAGATCTCGAGATCTGATCCATGTCACCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015190.3-731s1c1
Sequence:CCGGCAGCCATTCAGAGCAGACAAACTCGAGTTTGTCTGCTCTGAATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015190.3-731s21c1
Sequence:CCGGCAGCCATTCAGAGCAGACAAACTCGAGTTTGTCTGCTCTGAATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015190.3-1015s21c1
Sequence:CCGGTCAACCTGATCTTAGTATTTCCTCGAGGAAATACTAAGATCAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015190.3-592s21c1
Sequence:CCGGGTCCCATCCTATAATGCCTTTCTCGAGAAAGGCATTATAGGATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_015190.3-489s21c1
Sequence:CCGGCAAGGGTGACATGGATCAGATCTCGAGATCTGATCCATGTCACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015190.3-607s21c1
Sequence:CCGGGCCTTTGTCAAAGAATCGAAACTCGAGTTTCGATTCTTTGACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks