EMAIL THIS PAGE TO A FRIEND

DNAL1

dynein, axonemal, light chain 1

75 Gene Product Result for
Synonyms: C14orf168 CILD16
UniProtKB ID: Q4LDG9, B2RD38, Q5JPB7, Q9BS43
Gene ID:
Human(83544) Summary: This gene encodes an axonemal dynein light chain which functions as a component of the outer dynein arms complex. This complex acts as the molecular motor that provides the force to move cilia in an ATP-dependent manner. The encoded protein is expressed in tissues with motile cilia or flagella and may be involved in the movement of sperm flagella. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011]
Mouse(105000) dynein, axonemal, light chain 1
Rat(685664) dynein, axonemal, light chain 1
Zebrafish(445048) dynein, axonemal, light chain 1
chicken(423246) dynein, axonemal, light chain 1
domestic cat(101088251) dynein, axonemal, light chain 1
cow(538164) dynein, axonemal, light chain 1
dog(610370) dynein, axonemal, light chain 1
domestic guinea pig(100720074) dynein, axonemal, light chain 1
naked mole-rat(101711582) dynein, axonemal, light chain 1
sheep(101104495) dynein, axonemal, light chain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031427 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031427 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031427 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028821 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028821 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028821 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098251 MISSION® esiRNA esiRNA human DNAL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031427 Rosetta Predictions human pricing
NM_001109477 Rosetta Predictions rat pricing
NM_028821 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358827 predicted 222
2 SASI_Hs02_00358828 predicted 631
3 SASI_Hs01_00097519 predicted 348
4 SASI_Hs02_00358829 predicted 313
5 SASI_Hs01_00097520 predicted 480
6 SASI_Hs01_00097522 predicted 521
7 SASI_Hs01_00097523 predicted 582
8 SASI_Hs01_00097526 predicted 509
9 SASI_Hs02_00358830 predicted 594
10 SASI_Hs02_00358831 predicted 292
11 SASI_Hs01_00097518 predicted 406
12 SASI_Hs01_00097521 predicted 199
13 SASI_Hs01_00097524 predicted 259
14 SASI_Hs01_00097525 predicted 292
15 SASI_Hs01_00097527 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109477 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248779 predicted 219
2 SASI_Rn02_00248780 predicted 359
3 SASI_Rn02_00248781 predicted 333
4 SASI_Rn02_00248782 predicted 224
5 SASI_Rn02_00248783 predicted 248
6 SASI_Rn02_00248784 predicted 337
7 SASI_Rn02_00248785 predicted 360
8 SASI_Rn02_00248786 predicted 274
9 SASI_Rn02_00248787 predicted 391
10 SASI_Rn02_00248788 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028821 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065766 predicted 314
2 SASI_Mm01_00065767 predicted 216
3 SASI_Mm02_00334445 predicted 218
4 SASI_Mm02_00334446 predicted 982
5 SASI_Mm02_00334447 predicted 1016
6 SASI_Mm02_00334448 predicted 1121
7 SASI_Mm01_00065770 predicted 252
8 SASI_Mm02_00334449 predicted 345
9 SASI_Mm02_00334450 predicted 981
10 SASI_Mm01_00065772 predicted 427
11 SASI_Mm01_00065768 predicted 518
12 SASI_Mm01_00065769 predicted 277
13 SASI_Mm01_00065771 predicted 314
14 SASI_Mm01_00065773 predicted 400
15 SASI_Mm01_00065774 predicted 272
16 SASI_Mm01_00065775 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031427
VALIDATED
DNAL1 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, light chain 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031427.2-915s21c1
Sequence:CCGGTGGTAATGCCAACCTTATATACTCGAGTATATAAGGTTGGCATTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031427.2-293s21c1
Sequence:CCGGCCTTGTCCATGCTTGCTAATTCTCGAGAATTAGCAAGCATGGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031427.2-519s21c1
Sequence:CCGGGATTCTCTACATGTCTAATAACTCGAGTTATTAGACATGTAGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031427.2-694s21c1
Sequence:CCGGGATGGTACTCCAGTAATTAAACTCGAGTTTAATTACTGGAGTACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031427.2-456s21c1
Sequence:CCGGACTGTGGATCTCCTACAATTTCTCGAGAAATTGTAGGAGATCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031427.1-798s1c1
Sequence:CCGGGCCAACCTTATATATCGTATTCTCGAGAATACGATATATAAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031427.1-626s1c1
Sequence:CCGGCCACTGTGTGTTAACTTATTTCTCGAGAAATAAGTTAACACACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031427.1-513s1c1
Sequence:CCGGGCTGAGAATAACTGGATTGAACTCGAGTTCAATCCAGTTATTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031427.1-320s1c1
Sequence:CCGGCACATTAGAAGAACTGTGGATCTCGAGATCCACAGTTCTTCTAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_031427.1-731s1c1
Sequence:CCGGCAGATCACTCATTCTCATCTTCTCGAGAAGATGAGAATGAGTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031427.1-501s1c1
Sequence:CCGGGAGAAACATTCTGCTGAGAATCTCGAGATTCTCAGCAGAATGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031427
VALIDATED
DNAL1 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, light chain 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031427.2-915s21c1
Sequence:CCGGTGGTAATGCCAACCTTATATACTCGAGTATATAAGGTTGGCATTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031427.2-293s21c1
Sequence:CCGGCCTTGTCCATGCTTGCTAATTCTCGAGAATTAGCAAGCATGGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031427.2-519s21c1
Sequence:CCGGGATTCTCTACATGTCTAATAACTCGAGTTATTAGACATGTAGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031427.2-694s21c1
Sequence:CCGGGATGGTACTCCAGTAATTAAACTCGAGTTTAATTACTGGAGTACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031427.2-456s21c1
Sequence:CCGGACTGTGGATCTCCTACAATTTCTCGAGAAATTGTAGGAGATCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031427.1-798s1c1
Sequence:CCGGGCCAACCTTATATATCGTATTCTCGAGAATACGATATATAAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031427.1-626s1c1
Sequence:CCGGCCACTGTGTGTTAACTTATTTCTCGAGAAATAAGTTAACACACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031427.1-513s1c1
Sequence:CCGGGCTGAGAATAACTGGATTGAACTCGAGTTCAATCCAGTTATTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031427.1-320s1c1
Sequence:CCGGCACATTAGAAGAACTGTGGATCTCGAGATCCACAGTTCTTCTAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_031427.1-731s1c1
Sequence:CCGGCAGATCACTCATTCTCATCTTCTCGAGAAGATGAGAATGAGTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031427.1-501s1c1
Sequence:CCGGGAGAAACATTCTGCTGAGAATCTCGAGATTCTCAGCAGAATGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031427
VALIDATED
DNAL1 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, light chain 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031427.2-915s21c1
Sequence:CCGGTGGTAATGCCAACCTTATATACTCGAGTATATAAGGTTGGCATTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031427.2-293s21c1
Sequence:CCGGCCTTGTCCATGCTTGCTAATTCTCGAGAATTAGCAAGCATGGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031427.2-519s21c1
Sequence:CCGGGATTCTCTACATGTCTAATAACTCGAGTTATTAGACATGTAGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031427.2-694s21c1
Sequence:CCGGGATGGTACTCCAGTAATTAAACTCGAGTTTAATTACTGGAGTACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031427.2-456s21c1
Sequence:CCGGACTGTGGATCTCCTACAATTTCTCGAGAAATTGTAGGAGATCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031427.1-798s1c1
Sequence:CCGGGCCAACCTTATATATCGTATTCTCGAGAATACGATATATAAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031427.1-626s1c1
Sequence:CCGGCCACTGTGTGTTAACTTATTTCTCGAGAAATAAGTTAACACACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031427.1-513s1c1
Sequence:CCGGGCTGAGAATAACTGGATTGAACTCGAGTTCAATCCAGTTATTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031427.1-320s1c1
Sequence:CCGGCACATTAGAAGAACTGTGGATCTCGAGATCCACAGTTCTTCTAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_031427.1-731s1c1
Sequence:CCGGCAGATCACTCATTCTCATCTTCTCGAGAAGATGAGAATGAGTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031427.1-501s1c1
Sequence:CCGGGAGAAACATTCTGCTGAGAATCTCGAGATTCTCAGCAGAATGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028821
DNAL1 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, light chain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028821.1-382s1c1
Sequence:CCGGCCTTAGGAAGAAACAACATAACTCGAGTTATGTTGTTTCTTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028821.1-506s1c1
Sequence:CCGGGAAGATTCTCTACATGTCTAACTCGAGTTAGACATGTAGAGAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028821.1-317s1c1
Sequence:CCGGCCTGTCTACAAACTGCATTGACTCGAGTCAATGCAGTTTGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028821.1-479s1c1
Sequence:CCGGGAAAGGAATCCATGTAATGAACTCGAGTTCATTACATGGATTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028821.1-634s1c1
Sequence:CCGGGCAACTGGATCGATGAAGCAACTCGAGTTGCTTCATCGATCCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028821
DNAL1 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, light chain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028821.1-382s1c1
Sequence:CCGGCCTTAGGAAGAAACAACATAACTCGAGTTATGTTGTTTCTTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028821.1-506s1c1
Sequence:CCGGGAAGATTCTCTACATGTCTAACTCGAGTTAGACATGTAGAGAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028821.1-317s1c1
Sequence:CCGGCCTGTCTACAAACTGCATTGACTCGAGTCAATGCAGTTTGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028821.1-479s1c1
Sequence:CCGGGAAAGGAATCCATGTAATGAACTCGAGTTCATTACATGGATTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028821.1-634s1c1
Sequence:CCGGGCAACTGGATCGATGAAGCAACTCGAGTTGCTTCATCGATCCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028821
DNAL1 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, light chain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028821.1-382s1c1
Sequence:CCGGCCTTAGGAAGAAACAACATAACTCGAGTTATGTTGTTTCTTCCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028821.1-506s1c1
Sequence:CCGGGAAGATTCTCTACATGTCTAACTCGAGTTAGACATGTAGAGAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028821.1-317s1c1
Sequence:CCGGCCTGTCTACAAACTGCATTGACTCGAGTCAATGCAGTTTGTAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028821.1-479s1c1
Sequence:CCGGGAAAGGAATCCATGTAATGAACTCGAGTTCATTACATGGATTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028821.1-634s1c1
Sequence:CCGGGCAACTGGATCGATGAAGCAACTCGAGTTGCTTCATCGATCCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks