EMAIL THIS PAGE TO A FRIEND

DNAL4

dynein, axonemal, light chain 4

60 Gene Product Result for
Synonyms: PIG27
UniProtKB ID: O96015
Gene ID:
Human(10126) Summary: DNAL4 is a component of the dynein motor complex (Iwasaki et al., 2005 [PubMed 15454493]
Mouse(54152) dynein, axonemal, light chain 4
Rat(300078) dynein, axonemal, light chain 4
sheep(101106580) dynein, axonemal, light chain 4
naked mole-rat(101701945) dynein, axonemal, light chain 4
domestic guinea pig(100730733) dynein, axonemal, light chain 4
chicken(418019) dynein, axonemal, light chain 4
cow(618379) dynein, axonemal, light chain 4
domestic cat(101082167) dynein, axonemal, light chain 4
dog(474505) dynein, axonemal, light chain 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017470 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017470 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017470 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005740 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005740 Rosetta Predictions human pricing
NM_001009666 Rosetta Predictions rat pricing
NM_017470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080585 predicted 378
2 SASI_Hs01_00080586 predicted 452
3 SASI_Hs02_00340181 predicted 334
4 SASI_Hs01_00080587 predicted 242
5 SASI_Hs01_00080589 predicted 250
6 SASI_Hs01_00080590 predicted 354
7 SASI_Hs01_00080591 predicted 831
8 SASI_Hs01_00080592 predicted 318
9 SASI_Hs01_00080593 predicted 328
10 SASI_Hs01_00080594 predicted 286
11 SASI_Hs01_00080588 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093370 predicted 345
2 SASI_Rn01_00093371 predicted 307
3 SASI_Rn01_00093372 predicted 247
4 SASI_Rn01_00093373 predicted 997
5 SASI_Rn01_00093374 predicted 338
6 SASI_Rn01_00093375 predicted 429
7 SASI_Rn01_00093376 predicted 319
8 SASI_Rn01_00093377 predicted 251
9 SASI_Rn01_00093378 predicted 1000
10 SASI_Rn01_00093379 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096946 predicted 265
2 SASI_Mm01_00096947 predicted 826
3 SASI_Mm02_00323933 predicted 821
4 SASI_Mm02_00323934 predicted 825
5 SASI_Mm01_00096950 predicted 272
6 SASI_Mm01_00096951 predicted 814
7 SASI_Mm01_00096952 predicted 1034
8 SASI_Mm01_00096945 predicted 375
9 SASI_Mm02_00323935 predicted 905
10 SASI_Mm01_00096953 predicted 444
11 SASI_Mm01_00096948 predicted 304
12 SASI_Mm01_00096949 predicted 896
13 SASI_Mm01_00096954 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017470
VALIDATED
DNAL4 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, light chain 4
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017470.1-805s1c1
Sequence:CCGGCGGGATTCTTCTCCTTGAAATCTCGAGATTTCAAGGAGAAGAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017470.1-368s1c1
Sequence:CCGGCAACAATGAGAGTGCTGCAAACTCGAGTTTGCAGCACTCTCATTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017470.1-353s1c1
Sequence:CCGGTGAGAAATTCTCCAACAACAACTCGAGTTGTTGTTGGAGAATTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017470.1-395s1c1
Sequence:CCGGCAAGGAGACAATGGACAAGAACTCGAGTTCTTGTCCATTGTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017470.1-350s1c1
Sequence:CCGGCTGTGAGAAATTCTCCAACAACTCGAGTTGTTGGAGAATTTCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017470.2-544s21c1
Sequence:CCGGTGTGTGTGGAAGTGCTCCTGACTCGAGTCAGGAGCACTTCCACACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017470.2-417s21c1
Sequence:CCGGCAAGGAGACAATGGACAAGAACTCGAGTTCTTGTCCATTGTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017470.2-375s21c1
Sequence:CCGGTGAGAAATTCTCCAACAACAACTCGAGTTGTTGTTGGAGAATTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017470.2-504s21c1
Sequence:CCGGGAACCTCCTGTACCTGTACTTCTCGAGAAGTACAGGTACAGGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017470.2-827s21c1
Sequence:CCGGCGGGATTCTTCTCCTTGAAATCTCGAGATTTCAAGGAGAAGAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017470.2-276s21c1
Sequence:CCGGGGCTGACTATAAACGGCTGCACTCGAGTGCAGCCGTTTATAGTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017470.2-480s21c1
Sequence:CCGGGTTTGAGATCACCCACGAGGTCTCGAGACCTCGTGGGTGATCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017470
VALIDATED
DNAL4 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, light chain 4
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017470.1-805s1c1
Sequence:CCGGCGGGATTCTTCTCCTTGAAATCTCGAGATTTCAAGGAGAAGAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017470.1-368s1c1
Sequence:CCGGCAACAATGAGAGTGCTGCAAACTCGAGTTTGCAGCACTCTCATTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017470.1-353s1c1
Sequence:CCGGTGAGAAATTCTCCAACAACAACTCGAGTTGTTGTTGGAGAATTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017470.1-395s1c1
Sequence:CCGGCAAGGAGACAATGGACAAGAACTCGAGTTCTTGTCCATTGTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017470.1-350s1c1
Sequence:CCGGCTGTGAGAAATTCTCCAACAACTCGAGTTGTTGGAGAATTTCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017470.2-544s21c1
Sequence:CCGGTGTGTGTGGAAGTGCTCCTGACTCGAGTCAGGAGCACTTCCACACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017470.2-417s21c1
Sequence:CCGGCAAGGAGACAATGGACAAGAACTCGAGTTCTTGTCCATTGTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017470.2-375s21c1
Sequence:CCGGTGAGAAATTCTCCAACAACAACTCGAGTTGTTGTTGGAGAATTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017470.2-504s21c1
Sequence:CCGGGAACCTCCTGTACCTGTACTTCTCGAGAAGTACAGGTACAGGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017470.2-827s21c1
Sequence:CCGGCGGGATTCTTCTCCTTGAAATCTCGAGATTTCAAGGAGAAGAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017470.2-276s21c1
Sequence:CCGGGGCTGACTATAAACGGCTGCACTCGAGTGCAGCCGTTTATAGTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017470.2-480s21c1
Sequence:CCGGGTTTGAGATCACCCACGAGGTCTCGAGACCTCGTGGGTGATCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017470
VALIDATED
DNAL4 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, light chain 4
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017470.1-805s1c1
Sequence:CCGGCGGGATTCTTCTCCTTGAAATCTCGAGATTTCAAGGAGAAGAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017470.1-368s1c1
Sequence:CCGGCAACAATGAGAGTGCTGCAAACTCGAGTTTGCAGCACTCTCATTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017470.1-353s1c1
Sequence:CCGGTGAGAAATTCTCCAACAACAACTCGAGTTGTTGTTGGAGAATTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017470.1-395s1c1
Sequence:CCGGCAAGGAGACAATGGACAAGAACTCGAGTTCTTGTCCATTGTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017470.1-350s1c1
Sequence:CCGGCTGTGAGAAATTCTCCAACAACTCGAGTTGTTGGAGAATTTCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017470.2-544s21c1
Sequence:CCGGTGTGTGTGGAAGTGCTCCTGACTCGAGTCAGGAGCACTTCCACACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017470.2-417s21c1
Sequence:CCGGCAAGGAGACAATGGACAAGAACTCGAGTTCTTGTCCATTGTCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017470.2-375s21c1
Sequence:CCGGTGAGAAATTCTCCAACAACAACTCGAGTTGTTGTTGGAGAATTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017470.2-504s21c1
Sequence:CCGGGAACCTCCTGTACCTGTACTTCTCGAGAAGTACAGGTACAGGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017470.2-827s21c1
Sequence:CCGGCGGGATTCTTCTCCTTGAAATCTCGAGATTTCAAGGAGAAGAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017470.2-276s21c1
Sequence:CCGGGGCTGACTATAAACGGCTGCACTCGAGTGCAGCCGTTTATAGTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017470.2-480s21c1
Sequence:CCGGGTTTGAGATCACCCACGAGGTCTCGAGACCTCGTGGGTGATCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005740
VALIDATED
DNAL4 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, light chain 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005740.1-253s1c1
Sequence:CCGGCTGATTATAAGCGACTGCAGACTCGAGTCTGCAGTCGCTTATAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005740.2-949s1c1
Sequence:CCGGCCTTGTCATTAGTGGTCATATCTCGAGATATGACCACTAATGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005740.1-389s1c1
Sequence:CCGGGATCAAAGAGACAATGGACAACTCGAGTTGTCCATTGTCTCTTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005740.2-688s21c1
Sequence:CCGGACGCCCAGTGTGTGAACTTGACTCGAGTCAAGTTCACACACTGGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005740.2-660s21c1
Sequence:CCGGTTGTCTTTGTGTACCAGTTTCCTCGAGGAAACTGGTACACAAAGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005740.2-822s21c1
Sequence:CCGGGAGGTGGGAGATGAGATCTTCCTCGAGGAAGATCTCATCTCCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005740.2-453s21c1
Sequence:CCGGGGGCTTTGGGTTTGAGATCACCTCGAGGTGATCTCAAACCCAAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005740.2-288s21c1
Sequence:CCGGTCTGGTCAGGCACTCGGACATCTCGAGATGTCCGAGTGCCTGACCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005740.2-486s1c1
Sequence:CCGGGAACCTCCTCTACCTGTACTTCTCGAGAAGTACAGGTAGAGGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005740.2-344s1c1
Sequence:CCGGGTGTCACAGCCTGTGAGAAATCTCGAGATTTCTCACAGGCTGTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005740
VALIDATED
DNAL4 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, light chain 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005740.1-253s1c1
Sequence:CCGGCTGATTATAAGCGACTGCAGACTCGAGTCTGCAGTCGCTTATAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005740.2-949s1c1
Sequence:CCGGCCTTGTCATTAGTGGTCATATCTCGAGATATGACCACTAATGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005740.1-389s1c1
Sequence:CCGGGATCAAAGAGACAATGGACAACTCGAGTTGTCCATTGTCTCTTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005740.2-688s21c1
Sequence:CCGGACGCCCAGTGTGTGAACTTGACTCGAGTCAAGTTCACACACTGGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005740.2-660s21c1
Sequence:CCGGTTGTCTTTGTGTACCAGTTTCCTCGAGGAAACTGGTACACAAAGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005740.2-822s21c1
Sequence:CCGGGAGGTGGGAGATGAGATCTTCCTCGAGGAAGATCTCATCTCCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005740.2-453s21c1
Sequence:CCGGGGGCTTTGGGTTTGAGATCACCTCGAGGTGATCTCAAACCCAAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005740.2-288s21c1
Sequence:CCGGTCTGGTCAGGCACTCGGACATCTCGAGATGTCCGAGTGCCTGACCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005740.2-486s1c1
Sequence:CCGGGAACCTCCTCTACCTGTACTTCTCGAGAAGTACAGGTAGAGGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005740.2-344s1c1
Sequence:CCGGGTGTCACAGCCTGTGAGAAATCTCGAGATTTCTCACAGGCTGTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005740
VALIDATED
DNAL4 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, light chain 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005740.1-253s1c1
Sequence:CCGGCTGATTATAAGCGACTGCAGACTCGAGTCTGCAGTCGCTTATAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005740.2-949s1c1
Sequence:CCGGCCTTGTCATTAGTGGTCATATCTCGAGATATGACCACTAATGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005740.1-389s1c1
Sequence:CCGGGATCAAAGAGACAATGGACAACTCGAGTTGTCCATTGTCTCTTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005740.2-688s21c1
Sequence:CCGGACGCCCAGTGTGTGAACTTGACTCGAGTCAAGTTCACACACTGGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005740.2-660s21c1
Sequence:CCGGTTGTCTTTGTGTACCAGTTTCCTCGAGGAAACTGGTACACAAAGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005740.2-822s21c1
Sequence:CCGGGAGGTGGGAGATGAGATCTTCCTCGAGGAAGATCTCATCTCCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005740.2-453s21c1
Sequence:CCGGGGGCTTTGGGTTTGAGATCACCTCGAGGTGATCTCAAACCCAAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005740.2-288s21c1
Sequence:CCGGTCTGGTCAGGCACTCGGACATCTCGAGATGTCCGAGTGCCTGACCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005740.2-486s1c1
Sequence:CCGGGAACCTCCTCTACCTGTACTTCTCGAGAAGTACAGGTAGAGGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005740.2-344s1c1
Sequence:CCGGGTGTCACAGCCTGTGAGAAATCTCGAGATTTCTCACAGGCTGTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks