EMAIL THIS PAGE TO A FRIEND

DNALI1

dynein, axonemal, light intermediate chain 1

51 Gene Product Result for
Synonyms: P28 dJ423B22.5 hp28
UniProtKB ID: O14645, A8K387, Q05BL9, Q5HYE2, Q5TGH0, Q7L0I5
Gene ID:
Human(7802) Summary: This gene is the human homolog of the Chlamydomonas inner dynein arm gene, p28. The precise function of this gene is not known, however, it is a potential candidate for immotile cilia syndrome (ICS). Ultrastructural defects of the inner dynein arms are seen in patients with ICS. Immotile mutant strains of Chlamydomonas, a biflagellated algae, exhibit similar defects. [provided by RefSeq, Jul 2008]
Mouse(75563) dynein, axonemal, light intermediate polypeptide 1
Rat(298524) dynein, axonemal, light intermediate chain 1
Zebrafish(567632) dynein, axonemal, light intermediate chain 1
chicken(419615) dynein, axonemal, light intermediate chain 1
domestic cat(101090535) dynein, axonemal, light intermediate chain 1
cow(529053) dynein, axonemal, light intermediate chain 1
dog(482473) dynein, axonemal, light intermediate chain 1
domestic guinea pig(100729088) dynein, axonemal, light intermediate chain 1
naked mole-rat(101698493) dynein, axonemal, light intermediate chain 1
sheep(101114567) dynein, axonemal, light intermediate chain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003462 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175223 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175223 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175223 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070901 MISSION® esiRNA esiRNA human DNALI1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003462 Rosetta Predictions human pricing
NM_001031647 Rosetta Predictions rat pricing
NM_175223 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048620 predicted 1135
2 SASI_Hs01_00048621 predicted 869
3 SASI_Hs01_00048622 predicted 927
4 SASI_Hs01_00048623 predicted 999
5 SASI_Hs01_00048624 predicted 776
6 SASI_Hs01_00048626 predicted 1335
7 SASI_Hs01_00048627 predicted 1193
8 SASI_Hs01_00048628 predicted 854
9 SASI_Hs01_00048629 predicted 722
10 SASI_Hs02_00335710 predicted 1311
11 SASI_Hs01_00048625 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102806 predicted 1097
2 SASI_Rn01_00102808 predicted 1054
3 SASI_Rn01_00102809 predicted 716
4 SASI_Rn01_00102810 predicted 753
5 SASI_Rn02_00203583 predicted 1009
6 SASI_Rn02_00203584 predicted 1256
7 SASI_Rn01_00102812 predicted 617
8 SASI_Rn01_00102813 predicted 877
9 SASI_Rn01_00102814 predicted 806
10 SASI_Rn01_00102815 predicted 282
11 SASI_Rn01_00102807 predicted 375
12 SASI_Rn01_00102811 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089901 predicted 1159
2 SASI_Mm01_00089902 predicted 981
3 SASI_Mm01_00089904 predicted 1093
4 SASI_Mm01_00089905 predicted 1309
5 SASI_Mm01_00089906 predicted 918
6 SASI_Mm01_00089907 predicted 813
7 SASI_Mm01_00089909 predicted 1131
8 SASI_Mm02_00345899 predicted 212
9 SASI_Mm01_00089910 predicted 668
10 SASI_Mm02_00345900 predicted 341
11 SASI_Mm01_00089903 predicted 1076
12 SASI_Mm01_00089908 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003462
DNALI1 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, light intermediate chain 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003462.3-1006s21c1
Sequence:CCGGTTGTTAGAAGTCACACTATTACTCGAGTAATAGTGTGACTTCTAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003462.3-838s21c1
Sequence:CCGGTGCACCAAAGAAGTGATAATTCTCGAGAATTATCACTTCTTTGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003462.3-89s21c1
Sequence:CCGGGCAGACTCTTTGCTCAAGTACCTCGAGGTACTTGAGCAAAGAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003462.3-126s21c1
Sequence:CCGGTGAGCCGGAACACGGAGAAACCTCGAGGTTTCTCCGTGTTCCGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003462.3-388s1c1
Sequence:CCGGGCAGTTAGACTTAAAGCTGCACTCGAGTGCAGCTTTAAGTCTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003462.3-382s1c1
Sequence:CCGGCCAGGAGCAGTTAGACTTAAACTCGAGTTTAAGTCTAACTGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003462.3-763s1c1
Sequence:CCGGGAAGAAGCACAATGAGGAGATCTCGAGATCTCCTCATTGTGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003462.3-266s1c1
Sequence:CCGGCAGGCAGAAGAAATCTTGAATCTCGAGATTCAAGATTTCTTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003462
DNALI1 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, light intermediate chain 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003462.3-1006s21c1
Sequence:CCGGTTGTTAGAAGTCACACTATTACTCGAGTAATAGTGTGACTTCTAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003462.3-838s21c1
Sequence:CCGGTGCACCAAAGAAGTGATAATTCTCGAGAATTATCACTTCTTTGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003462.3-89s21c1
Sequence:CCGGGCAGACTCTTTGCTCAAGTACCTCGAGGTACTTGAGCAAAGAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003462.3-126s21c1
Sequence:CCGGTGAGCCGGAACACGGAGAAACCTCGAGGTTTCTCCGTGTTCCGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003462.3-388s1c1
Sequence:CCGGGCAGTTAGACTTAAAGCTGCACTCGAGTGCAGCTTTAAGTCTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003462.3-382s1c1
Sequence:CCGGCCAGGAGCAGTTAGACTTAAACTCGAGTTTAAGTCTAACTGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003462.3-763s1c1
Sequence:CCGGGAAGAAGCACAATGAGGAGATCTCGAGATCTCCTCATTGTGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003462.3-266s1c1
Sequence:CCGGCAGGCAGAAGAAATCTTGAATCTCGAGATTCAAGATTTCTTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003462
DNALI1 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, light intermediate chain 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003462.3-1006s21c1
Sequence:CCGGTTGTTAGAAGTCACACTATTACTCGAGTAATAGTGTGACTTCTAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003462.3-838s21c1
Sequence:CCGGTGCACCAAAGAAGTGATAATTCTCGAGAATTATCACTTCTTTGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003462.3-89s21c1
Sequence:CCGGGCAGACTCTTTGCTCAAGTACCTCGAGGTACTTGAGCAAAGAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003462.3-126s21c1
Sequence:CCGGTGAGCCGGAACACGGAGAAACCTCGAGGTTTCTCCGTGTTCCGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003462.3-388s1c1
Sequence:CCGGGCAGTTAGACTTAAAGCTGCACTCGAGTGCAGCTTTAAGTCTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003462.3-382s1c1
Sequence:CCGGCCAGGAGCAGTTAGACTTAAACTCGAGTTTAAGTCTAACTGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003462.3-763s1c1
Sequence:CCGGGAAGAAGCACAATGAGGAGATCTCGAGATCTCCTCATTGTGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003462.3-266s1c1
Sequence:CCGGCAGGCAGAAGAAATCTTGAATCTCGAGATTCAAGATTTCTTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175223
DNALI1 MISSION shRNA Bacterial Glycerol Stock
dynein, axonemal, light intermediate chain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175223.2-1104s1c1
Sequence:CCGGCCTTTGCATCAAGTTCGGTTTCTCGAGAAACCGAACTTGATGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175223.2-664s1c1
Sequence:CCGGGACTTGGAGAGGCAAGTGAATCTCGAGATTCACTTGCCTCTCCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175223.2-544s1c1
Sequence:CCGGGCTGCCTACCAGACTCTGTATCTCGAGATACAGAGTCTGGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175223.2-113s1c1
Sequence:CCGGGCCGGAATACAGAGAAACGGACTCGAGTCCGTTTCTCTGTATTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175223.2-813s1c1
Sequence:CCGGAGGCATTATCGCACCGAAGAACTCGAGTTCTTCGGTGCGATAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175223
DNALI1 MISSION shRNA shRNA Plasmid DNA
dynein, axonemal, light intermediate chain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175223.2-1104s1c1
Sequence:CCGGCCTTTGCATCAAGTTCGGTTTCTCGAGAAACCGAACTTGATGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175223.2-664s1c1
Sequence:CCGGGACTTGGAGAGGCAAGTGAATCTCGAGATTCACTTGCCTCTCCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175223.2-544s1c1
Sequence:CCGGGCTGCCTACCAGACTCTGTATCTCGAGATACAGAGTCTGGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175223.2-113s1c1
Sequence:CCGGGCCGGAATACAGAGAAACGGACTCGAGTCCGTTTCTCTGTATTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175223.2-813s1c1
Sequence:CCGGAGGCATTATCGCACCGAAGAACTCGAGTTCTTCGGTGCGATAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175223
DNALI1 MISSION shRNA Lentiviral Transduction Particles
dynein, axonemal, light intermediate chain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175223.2-1104s1c1
Sequence:CCGGCCTTTGCATCAAGTTCGGTTTCTCGAGAAACCGAACTTGATGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175223.2-664s1c1
Sequence:CCGGGACTTGGAGAGGCAAGTGAATCTCGAGATTCACTTGCCTCTCCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175223.2-544s1c1
Sequence:CCGGGCTGCCTACCAGACTCTGTATCTCGAGATACAGAGTCTGGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175223.2-113s1c1
Sequence:CCGGGCCGGAATACAGAGAAACGGACTCGAGTCCGTTTCTCTGTATTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175223.2-813s1c1
Sequence:CCGGAGGCATTATCGCACCGAAGAACTCGAGTTCTTCGGTGCGATAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks