EMAIL THIS PAGE TO A FRIEND

DNASE1

deoxyribonuclease I

61 Gene Product Result for
Synonyms: DNL1 DRNI
UniProtKB ID: P24855, Q14UU9, Q14UV0
Gene ID:
Human(1773) Summary: This gene encodes a member of the DNase family. This protein is stored in the zymogen granules of the nuclear envelope and functions by cleaving DNA in an endonucleolytic manner. At least six autosomal codominant alleles have been characterized, DNASE1*1 through DNASE1*6, and the sequence of DNASE1*2 represented in this record. Mutations in this gene have been associated with systemic lupus erythematosus (SLE), an autoimmune disease. A recombinant form of this protein is used to treat the one of the symptoms of cystic fibrosis by hydrolyzing the extracellular DNA in sputum and reducing its viscosity. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
Mouse(13419) deoxyribonuclease I
Rat(25633) deoxyribonuclease I
Zebrafish(436947) deoxyribonuclease I
dog(403413) deoxyribonuclease I
domestic cat(101096195) deoxyribonuclease I
cow(282217) deoxyribonuclease I
Horse(100034219) deoxyribonuclease I
chicken(395725) deoxyribonuclease I
sheep(101122154) deoxyribonuclease I
Domestic Rabbit(100009513) deoxyribonuclease I
naked mole-rat(101713435) deoxyribonuclease I
domestic guinea pig(100718441) deoxyribonuclease I
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010061 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010061 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010061 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005223 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005223 Rosetta Predictions human pricing
NM_013097 Rosetta Predictions rat pricing
NM_010061 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117035 predicted 2506
2 SASI_Hs01_00117036 predicted 2619
3 SASI_Hs01_00117037 predicted 2598
4 SASI_Hs01_00117038 predicted 2503
5 SASI_Hs01_00117040 predicted 2698
6 SASI_Hs02_00339210 predicted 2337
7 SASI_Hs01_00117041 predicted 2591
8 SASI_Hs01_00117042 predicted 2236
9 SASI_Hs01_00117043 predicted 2443
10 SASI_Hs01_00117044 predicted 2515
11 SASI_Hs01_00117039 predicted 2287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077238 predicted 1044
2 SASI_Rn02_00260866 predicted 334
3 SASI_Rn01_00077240 predicted 702
4 SASI_Rn01_00077241 predicted 779
5 SASI_Rn01_00077242 predicted 403
6 SASI_Rn01_00077243 predicted 725
7 SASI_Rn01_00077245 predicted 951
8 SASI_Rn01_00077246 predicted 492
9 SASI_Rn01_00077247 predicted 869
10 SASI_Rn02_00260867 predicted 519
11 SASI_Rn01_00077239 predicted 437
12 SASI_Rn01_00077244 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317721 predicted 793
2 SASI_Mm02_00317722 predicted 648
3 SASI_Mm02_00317723 predicted 615
4 SASI_Mm02_00317724 predicted 625
5 SASI_Mm01_00178690 predicted 524
6 SASI_Mm01_00178691 predicted 605
7 SASI_Mm02_00317725 predicted 1066
8 SASI_Mm02_00317726 predicted 994
9 SASI_Mm02_00317727 predicted 346
10 SASI_Mm02_00317728 predicted 956
11 SASI_Mm01_00178685 predicted 713
12 SASI_Mm01_00178686 predicted 682
13 SASI_Mm01_00178687 predicted 433
14 SASI_Mm01_00178688 predicted 307
15 SASI_Mm01_00178689 predicted 398
16 SASI_Mm01_00178692 predicted 775
17 SASI_Mm01_00178693 predicted 896
18 SASI_Mm01_00178694 predicted 757
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010061
DNASE1 MISSION shRNA Bacterial Glycerol Stock
deoxyribonuclease I
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010061.4-1161s1c1
Sequence:CCGGCTGCTTCTGGTGAGGAAGAATCTCGAGATTCTTCCTCACCAGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010061.4-654s1c1
Sequence:CCGGACCCTGTGGAAATGACACCTTCTCGAGAAGGTGTCATTTCCACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010061.4-684s1c1
Sequence:CCGGGCCAGCCATTGTTAAGTTCTTCTCGAGAAGAACTTAACAATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010061.4-408s1c1
Sequence:CCGGCCTCTCTGTATACTTTGTGAACTCGAGTTCACAAAGTATACAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010061.4-613s1c1
Sequence:CCGGGTGTCTATTCTGGACAGCTATCTCGAGATAGCTGTCCAGAATAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010061
DNASE1 MISSION shRNA shRNA Plasmid DNA
deoxyribonuclease I
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010061.4-1161s1c1
Sequence:CCGGCTGCTTCTGGTGAGGAAGAATCTCGAGATTCTTCCTCACCAGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010061.4-654s1c1
Sequence:CCGGACCCTGTGGAAATGACACCTTCTCGAGAAGGTGTCATTTCCACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010061.4-684s1c1
Sequence:CCGGGCCAGCCATTGTTAAGTTCTTCTCGAGAAGAACTTAACAATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010061.4-408s1c1
Sequence:CCGGCCTCTCTGTATACTTTGTGAACTCGAGTTCACAAAGTATACAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010061.4-613s1c1
Sequence:CCGGGTGTCTATTCTGGACAGCTATCTCGAGATAGCTGTCCAGAATAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010061
DNASE1 MISSION shRNA Lentiviral Transduction Particles
deoxyribonuclease I
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010061.4-1161s1c1
Sequence:CCGGCTGCTTCTGGTGAGGAAGAATCTCGAGATTCTTCCTCACCAGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010061.4-654s1c1
Sequence:CCGGACCCTGTGGAAATGACACCTTCTCGAGAAGGTGTCATTTCCACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010061.4-684s1c1
Sequence:CCGGGCCAGCCATTGTTAAGTTCTTCTCGAGAAGAACTTAACAATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010061.4-408s1c1
Sequence:CCGGCCTCTCTGTATACTTTGTGAACTCGAGTTCACAAAGTATACAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010061.4-613s1c1
Sequence:CCGGGTGTCTATTCTGGACAGCTATCTCGAGATAGCTGTCCAGAATAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005223
VALIDATED
DNASE1 MISSION shRNA Bacterial Glycerol Stock
deoxyribonuclease I
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005223.2-1501s1c1
Sequence:CCGGGTCAGGGAGTTTGCCATTGTTCTCGAGAACAATGGCAAACTCCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_005223.2-1812s1c1
Sequence:CCGGCTCGGCTCTTCCCTTTAACTTCTCGAGAAGTTAAAGGGAAGAGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005223.2-1580s1c1
Sequence:CCGGACCTGGATGTCCAAGAGAAATCTCGAGATTTCTCTTGGACATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005223.2-1141s1c1
Sequence:CCGGGCCTTCAACATCCAGACATTTCTCGAGAAATGTCTGGATGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005223.2-1552s1c1
Sequence:CCGGGCCGAGATCGACGCTCTCTATCTCGAGATAGAGAGCGTCGATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005223.3-2661s21c1
Sequence:CCGGTCATGTTGATGGGCGACTTCACTCGAGTGAAGTCGCCCATCAACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005223.3-2383s21c1
Sequence:CCGGACTGGGACGGAACAGCTATAACTCGAGTTATAGCTGTTCCGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005223.3-2855s21c1
Sequence:CCGGGACTCGGCTCTTCCCTTTAACCTCGAGGTTAAAGGGAAGAGCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005223.3-2443s21c1
Sequence:CCGGTGCGGTGGACAGCTACTACTACTCGAGTAGTAGTAGCTGTCCACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005223.3-2406s21c1
Sequence:CCGGAGCGCTACCTGTTCGTGTACACTCGAGTGTACACGAACAGGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005223
VALIDATED
DNASE1 MISSION shRNA shRNA Plasmid DNA
deoxyribonuclease I
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005223.2-1501s1c1
Sequence:CCGGGTCAGGGAGTTTGCCATTGTTCTCGAGAACAATGGCAAACTCCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_005223.2-1812s1c1
Sequence:CCGGCTCGGCTCTTCCCTTTAACTTCTCGAGAAGTTAAAGGGAAGAGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005223.2-1580s1c1
Sequence:CCGGACCTGGATGTCCAAGAGAAATCTCGAGATTTCTCTTGGACATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005223.2-1141s1c1
Sequence:CCGGGCCTTCAACATCCAGACATTTCTCGAGAAATGTCTGGATGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005223.2-1552s1c1
Sequence:CCGGGCCGAGATCGACGCTCTCTATCTCGAGATAGAGAGCGTCGATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005223.3-2661s21c1
Sequence:CCGGTCATGTTGATGGGCGACTTCACTCGAGTGAAGTCGCCCATCAACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005223.3-2383s21c1
Sequence:CCGGACTGGGACGGAACAGCTATAACTCGAGTTATAGCTGTTCCGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005223.3-2855s21c1
Sequence:CCGGGACTCGGCTCTTCCCTTTAACCTCGAGGTTAAAGGGAAGAGCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005223.3-2443s21c1
Sequence:CCGGTGCGGTGGACAGCTACTACTACTCGAGTAGTAGTAGCTGTCCACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005223.3-2406s21c1
Sequence:CCGGAGCGCTACCTGTTCGTGTACACTCGAGTGTACACGAACAGGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005223
VALIDATED
DNASE1 MISSION shRNA Lentiviral Transduction Particles
deoxyribonuclease I
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005223.2-1501s1c1
Sequence:CCGGGTCAGGGAGTTTGCCATTGTTCTCGAGAACAATGGCAAACTCCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_005223.2-1812s1c1
Sequence:CCGGCTCGGCTCTTCCCTTTAACTTCTCGAGAAGTTAAAGGGAAGAGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005223.2-1580s1c1
Sequence:CCGGACCTGGATGTCCAAGAGAAATCTCGAGATTTCTCTTGGACATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005223.2-1141s1c1
Sequence:CCGGGCCTTCAACATCCAGACATTTCTCGAGAAATGTCTGGATGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005223.2-1552s1c1
Sequence:CCGGGCCGAGATCGACGCTCTCTATCTCGAGATAGAGAGCGTCGATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005223.3-2661s21c1
Sequence:CCGGTCATGTTGATGGGCGACTTCACTCGAGTGAAGTCGCCCATCAACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005223.3-2383s21c1
Sequence:CCGGACTGGGACGGAACAGCTATAACTCGAGTTATAGCTGTTCCGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005223.3-2855s21c1
Sequence:CCGGGACTCGGCTCTTCCCTTTAACCTCGAGGTTAAAGGGAAGAGCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005223.3-2443s21c1
Sequence:CCGGTGCGGTGGACAGCTACTACTACTCGAGTAGTAGTAGCTGTCCACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005223.3-2406s21c1
Sequence:CCGGAGCGCTACCTGTTCGTGTACACTCGAGTGTACACGAACAGGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks