EMAIL THIS PAGE TO A FRIEND

DNASE1L1

deoxyribonuclease I-like 1

90 Gene Product Result for
Synonyms: DNAS1L1 DNASEX DNL1L G4.8 XIB
UniProtKB ID: P49184, D3DWW7, Q5HY41
Gene ID:
Human(1774) Summary: This gene encodes a member of the deoxyribonuclease family and the protein shows high sequence similarity to lysosomal DNase I. Alternate transcriptional splice variants, encoding the same protein, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(69537) deoxyribonuclease 1-like 1
Rat(363522) deoxyribonuclease 1-like 1
domestic guinea pig(100734307) deoxyribonuclease I-like 1
naked mole-rat(101703404) deoxyribonuclease I-like 1
sheep(101120146) deoxyribonuclease I-like 1
cow(515176) deoxyribonuclease I-like 1
dog(492250) deoxyribonuclease I-like 1
domestic cat(101091518) deoxyribonuclease I-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027109 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027109 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027109 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006730 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006730 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006730 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009932 Rosetta Predictions human pricing
NM_001009933 Rosetta Predictions human pricing
NM_001009934 Rosetta Predictions human pricing
NM_006730 Rosetta Predictions human pricing
NM_001014223 Rosetta Predictions rat pricing
NM_027109 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129886 predicted 1069
2 SASI_Hs01_00129887 predicted 1981
3 SASI_Hs01_00129888 predicted 1006
4 SASI_Hs01_00129889 predicted 1825
5 SASI_Hs01_00129890 predicted 1877
6 SASI_Hs01_00129893 predicted 1926
7 SASI_Hs01_00129894 predicted 957
8 SASI_Hs01_00129895 predicted 1887
9 SASI_Hs02_00305732 predicted 800
10 SASI_Hs02_00305733 predicted 931
11 SASI_Hs01_00129891 predicted 1898
12 SASI_Hs01_00129892 predicted 1981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102650 predicted 815
2 SASI_Hs01_00102651 predicted 1730
3 SASI_Hs01_00102652 predicted 742
4 SASI_Hs01_00102653 predicted 1566
5 SASI_Hs01_00102654 predicted 1612
6 SASI_Hs01_00102657 predicted 1666
7 SASI_Hs01_00102658 predicted 706
8 SASI_Hs01_00102659 predicted 1620
9 SASI_Hs02_00305734 predicted 541
10 SASI_Hs02_00305735 predicted 668
11 SASI_Hs01_00102655 predicted 1641
12 SASI_Hs01_00102656 predicted 1717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068195 predicted 727
2 SASI_Hs01_00068196 predicted 1640
3 SASI_Hs01_00068197 predicted 658
4 SASI_Hs01_00068198 predicted 1477
5 SASI_Hs01_00068199 predicted 1528
6 SASI_Hs01_00068202 predicted 1582
7 SASI_Hs01_00068203 predicted 620
8 SASI_Hs01_00068204 predicted 1535
9 SASI_Hs02_00305736 predicted 457
10 SASI_Hs02_00305737 predicted 585
11 SASI_Hs01_00068200 predicted 1551
12 SASI_Hs01_00068201 predicted 1638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048100 predicted 1213
2 SASI_Hs01_00048101 predicted 2126
3 SASI_Hs01_00048102 predicted 1143
4 SASI_Hs01_00048103 predicted 1968
5 SASI_Hs01_00048104 predicted 2015
6 SASI_Hs01_00048107 predicted 2058
7 SASI_Hs01_00048108 predicted 1099
8 SASI_Hs01_00048109 predicted 2025
9 SASI_Hs02_00342167 predicted 946
10 SASI_Hs02_00342168 predicted 1063
11 SASI_Hs01_00048105 predicted 2036
12 SASI_Hs01_00048106 predicted 2117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050943 predicted 1153
2 SASI_Rn01_00050945 predicted 428
3 SASI_Rn02_00201759 predicted 594
4 SASI_Rn01_00050946 predicted 412
5 SASI_Rn01_00050947 predicted 584
6 SASI_Rn01_00050948 predicted 1136
7 SASI_Rn01_00050950 predicted 503
8 SASI_Rn01_00050951 predicted 655
9 SASI_Rn01_00050952 predicted 742
10 SASI_Rn02_00201760 predicted 386
11 SASI_Rn01_00050944 predicted 456
12 SASI_Rn01_00050949 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027109 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331545 predicted 563
2 SASI_Mm01_00143394 predicted 539
3 SASI_Mm01_00143395 predicted 1262
4 SASI_Mm01_00143396 predicted 1112
5 SASI_Mm01_00143397 predicted 519
6 SASI_Mm01_00143398 predicted 862
7 SASI_Mm01_00143399 predicted 620
8 SASI_Mm01_00143400 predicted 1356
9 SASI_Mm01_00143401 predicted 1021
10 SASI_Mm01_00143402 predicted 1053
11 SASI_Mm01_00143403 predicted 850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027109
VALIDATED
DNASE1L1 MISSION shRNA Bacterial Glycerol Stock
deoxyribonuclease I-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027109.1-1161s21c1
Sequence:CCGGTCCGCATCAGTGACCATTATCCTCGAGGATAATGGTCACTGATGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027109.1-619s21c1
Sequence:CCGGCAGGAGTTACAGCTTCCTAAACTCGAGTTTAGGAAGCTGTAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027109.1-500s21c1
Sequence:CCGGGAGTCAGTGATGGATACCTTACTCGAGTAAGGTATCCATCACTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027109.1-1476s21c1
Sequence:CCGGGCTCAGATCATACCTAAGATTCTCGAGAATCTTAGGTATGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027109.1-698s21c1
Sequence:CCGGGACAAGACACAGGTCCTAAATCTCGAGATTTAGGACCTGTGTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027109.1-1476s1c1
Sequence:CCGGGCTCAGATCATACCTAAGATTCTCGAGAATCTTAGGTATGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027109.1-619s1c1
Sequence:CCGGCAGGAGTTACAGCTTCCTAAACTCGAGTTTAGGAAGCTGTAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027109.1-500s1c1
Sequence:CCGGGAGTCAGTGATGGATACCTTACTCGAGTAAGGTATCCATCACTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027109.1-773s1c1
Sequence:CCGGCATTTCACTCTCCCTAGCAAACTCGAGTTTGCTAGGGAGAGTGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027109
VALIDATED
DNASE1L1 MISSION shRNA shRNA Plasmid DNA
deoxyribonuclease I-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027109.1-1161s21c1
Sequence:CCGGTCCGCATCAGTGACCATTATCCTCGAGGATAATGGTCACTGATGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027109.1-619s21c1
Sequence:CCGGCAGGAGTTACAGCTTCCTAAACTCGAGTTTAGGAAGCTGTAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027109.1-500s21c1
Sequence:CCGGGAGTCAGTGATGGATACCTTACTCGAGTAAGGTATCCATCACTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027109.1-1476s21c1
Sequence:CCGGGCTCAGATCATACCTAAGATTCTCGAGAATCTTAGGTATGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027109.1-698s21c1
Sequence:CCGGGACAAGACACAGGTCCTAAATCTCGAGATTTAGGACCTGTGTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027109.1-1476s1c1
Sequence:CCGGGCTCAGATCATACCTAAGATTCTCGAGAATCTTAGGTATGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027109.1-619s1c1
Sequence:CCGGCAGGAGTTACAGCTTCCTAAACTCGAGTTTAGGAAGCTGTAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027109.1-500s1c1
Sequence:CCGGGAGTCAGTGATGGATACCTTACTCGAGTAAGGTATCCATCACTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027109.1-773s1c1
Sequence:CCGGCATTTCACTCTCCCTAGCAAACTCGAGTTTGCTAGGGAGAGTGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027109
VALIDATED
DNASE1L1 MISSION shRNA Lentiviral Transduction Particles
deoxyribonuclease I-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027109.1-1161s21c1
Sequence:CCGGTCCGCATCAGTGACCATTATCCTCGAGGATAATGGTCACTGATGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027109.1-619s21c1
Sequence:CCGGCAGGAGTTACAGCTTCCTAAACTCGAGTTTAGGAAGCTGTAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027109.1-500s21c1
Sequence:CCGGGAGTCAGTGATGGATACCTTACTCGAGTAAGGTATCCATCACTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027109.1-1476s21c1
Sequence:CCGGGCTCAGATCATACCTAAGATTCTCGAGAATCTTAGGTATGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027109.1-698s21c1
Sequence:CCGGGACAAGACACAGGTCCTAAATCTCGAGATTTAGGACCTGTGTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027109.1-1476s1c1
Sequence:CCGGGCTCAGATCATACCTAAGATTCTCGAGAATCTTAGGTATGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027109.1-619s1c1
Sequence:CCGGCAGGAGTTACAGCTTCCTAAACTCGAGTTTAGGAAGCTGTAACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027109.1-500s1c1
Sequence:CCGGGAGTCAGTGATGGATACCTTACTCGAGTAAGGTATCCATCACTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027109.1-773s1c1
Sequence:CCGGCATTTCACTCTCCCTAGCAAACTCGAGTTTGCTAGGGAGAGTGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006730
DNASE1L1 MISSION shRNA Bacterial Glycerol Stock
deoxyribonuclease I-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006730.2-980s21c1
Sequence:CCGGCGAGAACTCAATCGATTTGATCTCGAGATCAAATCGATTGAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006730.2-1623s21c1
Sequence:CCGGTCACTGTTCTGTTGCTGCTATCTCGAGATAGCAGCAACAGAACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006730.2-886s21c1
Sequence:CCGGGATGGACACCTTAGTTCGGATCTCGAGATCCGAACTAAGGTGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006730.2-1099s21c1
Sequence:CCGGCCTGAGTTCCTACGTGTACAACTCGAGTTGTACACGTAGGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006730.2-1046s21c1
Sequence:CCGGAGCACCTACATGGAGACGTATCTCGAGATACGTCTCCATGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006730.1-1005s1c1
Sequence:CCGGCGAGAACTCAATCGATTTGATCTCGAGATCAAATCGATTGAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006730.1-1124s1c1
Sequence:CCGGCCTGAGTTCCTACGTGTACAACTCGAGTTGTACACGTAGGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006730.1-1071s1c1
Sequence:CCGGAGCACCTACATGGAGACGTATCTCGAGATACGTCTCCATGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006730.1-1648s1c1
Sequence:CCGGTCACTGTTCTGTTGCTGCTATCTCGAGATAGCAGCAACAGAACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006730.1-911s1c1
Sequence:CCGGGATGGACACCTTAGTTCGGATCTCGAGATCCGAACTAAGGTGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006730
DNASE1L1 MISSION shRNA shRNA Plasmid DNA
deoxyribonuclease I-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006730.2-980s21c1
Sequence:CCGGCGAGAACTCAATCGATTTGATCTCGAGATCAAATCGATTGAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006730.2-1623s21c1
Sequence:CCGGTCACTGTTCTGTTGCTGCTATCTCGAGATAGCAGCAACAGAACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006730.2-886s21c1
Sequence:CCGGGATGGACACCTTAGTTCGGATCTCGAGATCCGAACTAAGGTGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006730.2-1099s21c1
Sequence:CCGGCCTGAGTTCCTACGTGTACAACTCGAGTTGTACACGTAGGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006730.2-1046s21c1
Sequence:CCGGAGCACCTACATGGAGACGTATCTCGAGATACGTCTCCATGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006730.1-1005s1c1
Sequence:CCGGCGAGAACTCAATCGATTTGATCTCGAGATCAAATCGATTGAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006730.1-1124s1c1
Sequence:CCGGCCTGAGTTCCTACGTGTACAACTCGAGTTGTACACGTAGGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006730.1-1071s1c1
Sequence:CCGGAGCACCTACATGGAGACGTATCTCGAGATACGTCTCCATGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006730.1-1648s1c1
Sequence:CCGGTCACTGTTCTGTTGCTGCTATCTCGAGATAGCAGCAACAGAACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006730.1-911s1c1
Sequence:CCGGGATGGACACCTTAGTTCGGATCTCGAGATCCGAACTAAGGTGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006730
DNASE1L1 MISSION shRNA Lentiviral Transduction Particles
deoxyribonuclease I-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006730.2-980s21c1
Sequence:CCGGCGAGAACTCAATCGATTTGATCTCGAGATCAAATCGATTGAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006730.2-1623s21c1
Sequence:CCGGTCACTGTTCTGTTGCTGCTATCTCGAGATAGCAGCAACAGAACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006730.2-886s21c1
Sequence:CCGGGATGGACACCTTAGTTCGGATCTCGAGATCCGAACTAAGGTGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006730.2-1099s21c1
Sequence:CCGGCCTGAGTTCCTACGTGTACAACTCGAGTTGTACACGTAGGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006730.2-1046s21c1
Sequence:CCGGAGCACCTACATGGAGACGTATCTCGAGATACGTCTCCATGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006730.1-1005s1c1
Sequence:CCGGCGAGAACTCAATCGATTTGATCTCGAGATCAAATCGATTGAGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006730.1-1124s1c1
Sequence:CCGGCCTGAGTTCCTACGTGTACAACTCGAGTTGTACACGTAGGAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006730.1-1071s1c1
Sequence:CCGGAGCACCTACATGGAGACGTATCTCGAGATACGTCTCCATGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006730.1-1648s1c1
Sequence:CCGGTCACTGTTCTGTTGCTGCTATCTCGAGATAGCAGCAACAGAACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006730.1-911s1c1
Sequence:CCGGGATGGACACCTTAGTTCGGATCTCGAGATCCGAACTAAGGTGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks