EMAIL THIS PAGE TO A FRIEND

DNASE1L2

deoxyribonuclease I-like 2

Synonyms: DNAS1L2
UniProtKB ID: Q92874
Gene ID:
Mouse(66705) deoxyribonuclease 1-like 2
Rat(681124) deoxyribonuclease I-like 2
chicken(427682) deoxyribonuclease I-like 2
cow(787784) deoxyribonuclease I-like 2
domestic cat(101081692) deoxyribonuclease I-like 2
dog(490060) deoxyribonuclease I-like 2
sheep(101115336) deoxyribonuclease I-like 2
naked mole-rat(101703343) deoxyribonuclease I-like 2
domestic guinea pig(100733461) deoxyribonuclease I-like 2
Gene Class: Calcium_Binding
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025718 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025718 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025718 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001374 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120221 MISSION® esiRNA esiRNA human DNASE1L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001374 Rosetta Predictions human pricing
XM_001057412 Rosetta Predictions rat pricing
NM_025718 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214458 predicted 995
2 SASI_Hs01_00214459 predicted 970
3 SASI_Hs01_00214460 predicted 966
4 SASI_Hs01_00214461 predicted 270
5 SASI_Hs01_00214462 predicted 272
6 SASI_Hs01_00214463 predicted 840
7 SASI_Hs01_00214464 predicted 934
8 SASI_Hs01_00214465 predicted 276
9 SASI_Hs01_00214466 predicted 943
10 SASI_Hs01_00214467 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057412 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286245 predicted 1098
2 SASI_Rn02_00286246 predicted 1389
3 SASI_Rn02_00286247 predicted 1298
4 SASI_Rn02_00286248 predicted 1464
5 SASI_Rn02_00286249 predicted 1473
6 SASI_Rn02_00286250 predicted 1184
7 SASI_Rn02_00286251 predicted 1158
8 SASI_Rn02_00286252 predicted 1077
9 SASI_Rn02_00286253 predicted 1036
10 SASI_Rn02_00286254 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328901 predicted 645
2 SASI_Mm01_00046226 predicted 778
3 SASI_Mm01_00046227 predicted 766
4 SASI_Mm01_00046228 predicted 246
5 SASI_Mm01_00046229 predicted 507
6 SASI_Mm01_00046230 predicted 712
7 SASI_Mm02_00328902 predicted 629
8 SASI_Mm01_00046231 predicted 924
9 SASI_Mm02_00328903 predicted 401
10 SASI_Mm01_00046232 predicted 729
11 SASI_Mm01_00046224 predicted 378
12 SASI_Mm01_00046225 predicted 826
13 SASI_Mm01_00046233 predicted 375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025718
DNASE1L2 MISSION shRNA Bacterial Glycerol Stock
deoxyribonuclease I-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025718.1-1288s1c1
Sequence:CCGGGACTCCTTAAAGCTCCCATTTCTCGAGAAATGGGAGCTTTAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025718.1-512s1c1
Sequence:CCGGCCTTGCTCATGGAGCAAATTACTCGAGTAATTTGCTCCATGAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025718.1-840s1c1
Sequence:CCGGGCTGTTTCTGTGTGACTTTAACTCGAGTTAAAGTCACACAGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025718.1-847s1c1
Sequence:CCGGCTGTGTGACTTTAATGCCGATCTCGAGATCGGCATTAAAGTCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025718.1-607s1c1
Sequence:CCGGCTGTTTGTTTACAGGAAAGATCTCGAGATCTTTCCTGTAAACAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025718
DNASE1L2 MISSION shRNA shRNA Plasmid DNA
deoxyribonuclease I-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025718.1-1288s1c1
Sequence:CCGGGACTCCTTAAAGCTCCCATTTCTCGAGAAATGGGAGCTTTAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025718.1-512s1c1
Sequence:CCGGCCTTGCTCATGGAGCAAATTACTCGAGTAATTTGCTCCATGAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025718.1-840s1c1
Sequence:CCGGGCTGTTTCTGTGTGACTTTAACTCGAGTTAAAGTCACACAGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025718.1-847s1c1
Sequence:CCGGCTGTGTGACTTTAATGCCGATCTCGAGATCGGCATTAAAGTCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025718.1-607s1c1
Sequence:CCGGCTGTTTGTTTACAGGAAAGATCTCGAGATCTTTCCTGTAAACAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025718
DNASE1L2 MISSION shRNA Lentiviral Transduction Particles
deoxyribonuclease I-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025718.1-1288s1c1
Sequence:CCGGGACTCCTTAAAGCTCCCATTTCTCGAGAAATGGGAGCTTTAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025718.1-512s1c1
Sequence:CCGGCCTTGCTCATGGAGCAAATTACTCGAGTAATTTGCTCCATGAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025718.1-840s1c1
Sequence:CCGGGCTGTTTCTGTGTGACTTTAACTCGAGTTAAAGTCACACAGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025718.1-847s1c1
Sequence:CCGGCTGTGTGACTTTAATGCCGATCTCGAGATCGGCATTAAAGTCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025718.1-607s1c1
Sequence:CCGGCTGTTTGTTTACAGGAAAGATCTCGAGATCTTTCCTGTAAACAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001374
DNASE1L2 MISSION shRNA Bacterial Glycerol Stock
deoxyribonuclease I-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001374.2-272s1c1
Sequence:CCGGGCGAAGATCCTGGCTGGCTATCTCGAGATAGCCAGCCAGGATCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001374.2-196s1c1
Sequence:CCGGGCTTCGCATCGGAGCCTTCAACTCGAGTTGAAGGCTCCGATGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001374.2-673s1c1
Sequence:CCGGCGACGCGCTCTACGACGTGTACTCGAGTACACGTCGTAGAGCGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001374.2-343s1c1
Sequence:CCGGCGCGCTCATGGAGCAGATCAACTCGAGTTGATCTGCTCCATGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001374.2-514s1c1
Sequence:CCGGCGAGCCCTTCGTGGTCAAGTTCTCGAGAACTTGACCACGAAGGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001374.2-979s21c1
Sequence:CCGGTCTTGCCATCAGCGACCACTTCTCGAGAAGTGGTCGCTGATGGCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001374.2-428s21c1
Sequence:CCGGGAGATGTACCTGTTCGTGTACCTCGAGGTACACGAACAGGTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001374.2-1172s21c1
Sequence:CCGGCACGTGATGTGCTGCTCTGTACTCGAGTACAGAGCAGCACATCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001374
DNASE1L2 MISSION shRNA shRNA Plasmid DNA
deoxyribonuclease I-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001374.2-272s1c1
Sequence:CCGGGCGAAGATCCTGGCTGGCTATCTCGAGATAGCCAGCCAGGATCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001374.2-196s1c1
Sequence:CCGGGCTTCGCATCGGAGCCTTCAACTCGAGTTGAAGGCTCCGATGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001374.2-673s1c1
Sequence:CCGGCGACGCGCTCTACGACGTGTACTCGAGTACACGTCGTAGAGCGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001374.2-343s1c1
Sequence:CCGGCGCGCTCATGGAGCAGATCAACTCGAGTTGATCTGCTCCATGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001374.2-514s1c1
Sequence:CCGGCGAGCCCTTCGTGGTCAAGTTCTCGAGAACTTGACCACGAAGGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001374.2-979s21c1
Sequence:CCGGTCTTGCCATCAGCGACCACTTCTCGAGAAGTGGTCGCTGATGGCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001374.2-428s21c1
Sequence:CCGGGAGATGTACCTGTTCGTGTACCTCGAGGTACACGAACAGGTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001374.2-1172s21c1
Sequence:CCGGCACGTGATGTGCTGCTCTGTACTCGAGTACAGAGCAGCACATCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001374
DNASE1L2 MISSION shRNA Lentiviral Transduction Particles
deoxyribonuclease I-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001374.2-272s1c1
Sequence:CCGGGCGAAGATCCTGGCTGGCTATCTCGAGATAGCCAGCCAGGATCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001374.2-196s1c1
Sequence:CCGGGCTTCGCATCGGAGCCTTCAACTCGAGTTGAAGGCTCCGATGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001374.2-673s1c1
Sequence:CCGGCGACGCGCTCTACGACGTGTACTCGAGTACACGTCGTAGAGCGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001374.2-343s1c1
Sequence:CCGGCGCGCTCATGGAGCAGATCAACTCGAGTTGATCTGCTCCATGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001374.2-514s1c1
Sequence:CCGGCGAGCCCTTCGTGGTCAAGTTCTCGAGAACTTGACCACGAAGGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001374.2-979s21c1
Sequence:CCGGTCTTGCCATCAGCGACCACTTCTCGAGAAGTGGTCGCTGATGGCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001374.2-428s21c1
Sequence:CCGGGAGATGTACCTGTTCGTGTACCTCGAGGTACACGAACAGGTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001374.2-1172s21c1
Sequence:CCGGCACGTGATGTGCTGCTCTGTACTCGAGTACAGAGCAGCACATCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks