EMAIL THIS PAGE TO A FRIEND

DNASE1L3

deoxyribonuclease I-like 3

73 Gene Product Result for
Synonyms: DHP2 DNAS1L3 LSD SLEB16
UniProtKB ID: Q13609, B2R8B1, B7Z707, O75803
Gene ID:
Human(1776) Summary: This gene encodes a member of the deoxyribonuclease I family. The encoded protein hydrolyzes DNA, is not inhibited by actin, and mediates the breakdown of DNA during apoptosis. Mutations in this gene are a cause of systemic lupus erythematosus-16. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Mouse(13421) deoxyribonuclease 1-like 3
Rat(116687) deoxyribonuclease 1-like 3
domestic guinea pig(100721857) deoxyribonuclease I-like 3
naked mole-rat(101715680) deoxyribonuclease I-like 3
sheep(101122895) deoxyribonuclease I-like 3
Zebrafish(792196) deoxyribonuclease I-like 3
cow(512512) deoxyribonuclease I-like 3
domestic cat(101099361) deoxyribonuclease I-like 3
dog(476576) deoxyribonuclease I-like 3
chicken(416008) deoxyribonuclease I-like 3
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004944 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004944 Rosetta Predictions human pricing
NM_053907 Rosetta Predictions rat pricing
NM_007870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078148 predicted 597
2 SASI_Hs01_00078149 predicted 1185
3 SASI_Hs01_00078150 predicted 820
4 SASI_Hs01_00078151 predicted 555
5 SASI_Hs01_00078152 predicted 850
6 SASI_Hs01_00078153 predicted 917
7 SASI_Hs01_00078154 predicted 776
8 SASI_Hs01_00078155 predicted 950
9 SASI_Hs01_00078156 predicted 912
10 SASI_Hs01_00078157 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113581 predicted 1028
2 SASI_Rn01_00113582 predicted 510
3 SASI_Rn02_00266839 predicted 451
4 SASI_Rn01_00113583 predicted 330
5 SASI_Rn01_00113584 predicted 1036
6 SASI_Rn01_00113585 predicted 290
7 SASI_Rn01_00113586 predicted 694
8 SASI_Rn01_00113587 predicted 446
9 SASI_Rn01_00113588 predicted 988
10 SASI_Rn01_00113589 predicted 501
11 SASI_Rn01_00113590 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096925 predicted 441
2 SASI_Mm01_00096926 predicted 684
3 SASI_Mm01_00096927 predicted 507
4 SASI_Mm01_00096928 predicted 367
5 SASI_Mm01_00096929 predicted 466
6 SASI_Mm01_00096930 predicted 902
7 SASI_Mm01_00096931 predicted 711
8 SASI_Mm01_00096932 predicted 562
9 SASI_Mm01_00096933 predicted 397
10 SASI_Mm01_00096934 predicted 425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004944
DNASE1L3 MISSION shRNA Bacterial Glycerol Stock
deoxyribonuclease I-like 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004944.2-1021s21c1
Sequence:CCGGGGAAGGCGGAGAATTTCATTTCTCGAGAAATGAAATTCTCCGCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004944.2-733s21c1
Sequence:CCGGTAACGTACAACTATGTGATTACTCGAGTAATCACATAGTTGTACGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004944.2-559s21c1
Sequence:CCGGCCTTCAACGTCAGGTCCTTTGCTCGAGCAAAGGACCTGACGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004944.2-966s21c1
Sequence:CCGGTCCGTTAAGGAGATCGATGAGCTCGAGCTCATCGATCTCCTTAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004944.1-503s1c1
Sequence:CCGGGCTGTCAAAGACTTCGTGATTCTCGAGAATCACGAAGTCTTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004944.1-346s1c1
Sequence:CCGGGCTTGGAAGAAACACATATAACTCGAGTTATATGTGTTTCTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004944.1-786s1c1
Sequence:CCGGGAGGACAAGAAATCGTCAGTTCTCGAGAACTGACGATTTCTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004944.1-227s1c1
Sequence:CCGGGACATCATACTCGTGATGGAACTCGAGTTCCATCACGAGTATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004944.1-886s1c1
Sequence:CCGGCGACCACTTTCCAGTTGAATTCTCGAGAATTCAACTGGAAAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004944
DNASE1L3 MISSION shRNA shRNA Plasmid DNA
deoxyribonuclease I-like 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004944.2-1021s21c1
Sequence:CCGGGGAAGGCGGAGAATTTCATTTCTCGAGAAATGAAATTCTCCGCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004944.2-733s21c1
Sequence:CCGGTAACGTACAACTATGTGATTACTCGAGTAATCACATAGTTGTACGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004944.2-559s21c1
Sequence:CCGGCCTTCAACGTCAGGTCCTTTGCTCGAGCAAAGGACCTGACGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004944.2-966s21c1
Sequence:CCGGTCCGTTAAGGAGATCGATGAGCTCGAGCTCATCGATCTCCTTAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004944.1-503s1c1
Sequence:CCGGGCTGTCAAAGACTTCGTGATTCTCGAGAATCACGAAGTCTTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004944.1-346s1c1
Sequence:CCGGGCTTGGAAGAAACACATATAACTCGAGTTATATGTGTTTCTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004944.1-786s1c1
Sequence:CCGGGAGGACAAGAAATCGTCAGTTCTCGAGAACTGACGATTTCTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004944.1-227s1c1
Sequence:CCGGGACATCATACTCGTGATGGAACTCGAGTTCCATCACGAGTATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004944.1-886s1c1
Sequence:CCGGCGACCACTTTCCAGTTGAATTCTCGAGAATTCAACTGGAAAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004944
DNASE1L3 MISSION shRNA Lentiviral Transduction Particles
deoxyribonuclease I-like 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004944.2-1021s21c1
Sequence:CCGGGGAAGGCGGAGAATTTCATTTCTCGAGAAATGAAATTCTCCGCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004944.2-733s21c1
Sequence:CCGGTAACGTACAACTATGTGATTACTCGAGTAATCACATAGTTGTACGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004944.2-559s21c1
Sequence:CCGGCCTTCAACGTCAGGTCCTTTGCTCGAGCAAAGGACCTGACGTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004944.2-966s21c1
Sequence:CCGGTCCGTTAAGGAGATCGATGAGCTCGAGCTCATCGATCTCCTTAACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004944.1-503s1c1
Sequence:CCGGGCTGTCAAAGACTTCGTGATTCTCGAGAATCACGAAGTCTTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004944.1-346s1c1
Sequence:CCGGGCTTGGAAGAAACACATATAACTCGAGTTATATGTGTTTCTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004944.1-786s1c1
Sequence:CCGGGAGGACAAGAAATCGTCAGTTCTCGAGAACTGACGATTTCTTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004944.1-227s1c1
Sequence:CCGGGACATCATACTCGTGATGGAACTCGAGTTCCATCACGAGTATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004944.1-886s1c1
Sequence:CCGGCGACCACTTTCCAGTTGAATTCTCGAGAATTCAACTGGAAAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007870
DNASE1L3 MISSION shRNA Bacterial Glycerol Stock
deoxyribonuclease I-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007870.2-1280s1c1
Sequence:CCGGCCTGCGAAACATTGCCACTATCTCGAGATAGTGGCAATGTTTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007870.2-324s1c1
Sequence:CCGGCCTTATACTGTTGATGGAAATCTCGAGATTTCCATCAACAGTATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007870.2-442s1c1
Sequence:CCGGCTTGGAAGAAACACGTACAAACTCGAGTTTGTACGTGTTTCTTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007870.2-317s1c1
Sequence:CCGGGCTGTGACCTTATACTGTTGACTCGAGTCAACAGTATAAGGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007870.2-598s1c1
Sequence:CCGGGCTGTCAAGGACTTCGTGATTCTCGAGAATCACGAAGTCCTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007870
DNASE1L3 MISSION shRNA shRNA Plasmid DNA
deoxyribonuclease I-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007870.2-1280s1c1
Sequence:CCGGCCTGCGAAACATTGCCACTATCTCGAGATAGTGGCAATGTTTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007870.2-324s1c1
Sequence:CCGGCCTTATACTGTTGATGGAAATCTCGAGATTTCCATCAACAGTATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007870.2-442s1c1
Sequence:CCGGCTTGGAAGAAACACGTACAAACTCGAGTTTGTACGTGTTTCTTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007870.2-317s1c1
Sequence:CCGGGCTGTGACCTTATACTGTTGACTCGAGTCAACAGTATAAGGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007870.2-598s1c1
Sequence:CCGGGCTGTCAAGGACTTCGTGATTCTCGAGAATCACGAAGTCCTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007870
DNASE1L3 MISSION shRNA Lentiviral Transduction Particles
deoxyribonuclease I-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007870.2-1280s1c1
Sequence:CCGGCCTGCGAAACATTGCCACTATCTCGAGATAGTGGCAATGTTTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007870.2-324s1c1
Sequence:CCGGCCTTATACTGTTGATGGAAATCTCGAGATTTCCATCAACAGTATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007870.2-442s1c1
Sequence:CCGGCTTGGAAGAAACACGTACAAACTCGAGTTTGTACGTGTTTCTTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007870.2-317s1c1
Sequence:CCGGGCTGTGACCTTATACTGTTGACTCGAGTCAACAGTATAAGGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007870.2-598s1c1
Sequence:CCGGGCTGTCAAGGACTTCGTGATTCTCGAGAATCACGAAGTCCTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks