EMAIL THIS PAGE TO A FRIEND

DNASE2

deoxyribonuclease II, lysosomal

39 Gene Product Result for
Synonyms: DNASE2A DNL DNL2
UniProtKB ID: O00115, B2RD06, O43910
Gene ID:
Human(1777) Summary: This gene encodes a member of the DNase family. The protein, located in the lysosome, hydrolyzes DNA under acidic conditions and mediates the breakdown of DNA during erythropoiesis and apoptosis. Two codominant alleles have been characterized, DNASE2*L (low activity) and DNASE2*H (high activity), that differ at one nucleotide in the promoter region. The DNASE2*H allele is represented in this record. [provided by RefSeq, Jul 2008]
Rat(171575) deoxyribonuclease II, lysosomal
Zebrafish(100000399) deoxyribonuclease II, lysosomal
fruit fly(5656872) Deoxyribonuclease 2
dog(476697) deoxyribonuclease II, lysosomal
domestic cat(101086631) deoxyribonuclease II, lysosomal
cow(282218) deoxyribonuclease II, lysosomal
sheep(101105493) deoxyribonuclease II, lysosomal
naked mole-rat(101716162) deoxyribonuclease II, lysosomal
domestic guinea pig(100728975) deoxyribonuclease II, lysosomal
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001375 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001375 Rosetta Predictions human pricing
NM_138539 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103477 predicted 581
2 SASI_Hs01_00103479 predicted 881
3 SASI_Hs01_00103480 predicted 279
4 SASI_Hs01_00103481 predicted 933
5 SASI_Hs02_00331722 predicted 225
6 SASI_Hs02_00331723 predicted 575
7 SASI_Hs01_00103484 predicted 942
8 SASI_Hs01_00103485 predicted 737
9 SASI_Hs01_00103486 predicted 861
10 SASI_Hs02_00331724 predicted 218
11 SASI_Hs01_00103478 predicted 770
12 SASI_Hs01_00103482 predicted 948
13 SASI_Hs01_00103483 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052554 predicted 1005
2 SASI_Rn01_00052555 predicted 210
3 SASI_Rn01_00052556 predicted 762
4 SASI_Rn02_00268177 predicted 1001
5 SASI_Rn01_00052557 predicted 548
6 SASI_Rn01_00052558 predicted 396
7 SASI_Rn01_00052561 predicted 686
8 SASI_Rn01_00052562 predicted 768
9 SASI_Rn01_00052563 predicted 297
10 SASI_Rn02_00268178 predicted 874
11 SASI_Rn01_00052559 predicted 636
12 SASI_Rn01_00052560 predicted 403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001375
VALIDATED
DNASE2 MISSION shRNA Bacterial Glycerol Stock
deoxyribonuclease II, lysosomal
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001375.1-474s1c1
Sequence:CCGGGCTGGTCCACAGTGTACCTAACTCGAGTTAGGTACACTGTGGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001375.1-882s1c1
Sequence:CCGGGCCCTCTAACTGCTCGGATATCTCGAGATATCCGAGCAGTTAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001375.1-582s1c1
Sequence:CCGGCTTCGCTCAGTTCTCGAAGATCTCGAGATCTTCGAGAACTGAGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001375.1-774s1c1
Sequence:CCGGCTTTGCCAAGTTCAGCAAATTCTCGAGAATTTGCTGAACTTGGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001375.1-1116s1c1
Sequence:CCGGGAAGAACTACCAGCCCTGTAACTCGAGTTACAGGGCTGGTAGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001375.2-527s21c1
Sequence:CCGGGCTGGTCCACAGTGTACCTAACTCGAGTTAGGTACACTGTGGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001375.2-935s21c1
Sequence:CCGGGCCCTCTAACTGCTCGGATATCTCGAGATATCCGAGCAGTTAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001375.2-827s21c1
Sequence:CCGGCTTTGCCAAGTTCAGCAAATTCTCGAGAATTTGCTGAACTTGGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001375.2-1169s21c1
Sequence:CCGGGAAGAACTACCAGCCCTGTAACTCGAGTTACAGGGCTGGTAGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001375.2-635s21c1
Sequence:CCGGCTTCGCTCAGTTCTCGAAGATCTCGAGATCTTCGAGAACTGAGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001375
VALIDATED
DNASE2 MISSION shRNA shRNA Plasmid DNA
deoxyribonuclease II, lysosomal
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001375.1-474s1c1
Sequence:CCGGGCTGGTCCACAGTGTACCTAACTCGAGTTAGGTACACTGTGGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001375.1-882s1c1
Sequence:CCGGGCCCTCTAACTGCTCGGATATCTCGAGATATCCGAGCAGTTAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001375.1-582s1c1
Sequence:CCGGCTTCGCTCAGTTCTCGAAGATCTCGAGATCTTCGAGAACTGAGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001375.1-774s1c1
Sequence:CCGGCTTTGCCAAGTTCAGCAAATTCTCGAGAATTTGCTGAACTTGGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001375.1-1116s1c1
Sequence:CCGGGAAGAACTACCAGCCCTGTAACTCGAGTTACAGGGCTGGTAGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001375.2-527s21c1
Sequence:CCGGGCTGGTCCACAGTGTACCTAACTCGAGTTAGGTACACTGTGGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001375.2-935s21c1
Sequence:CCGGGCCCTCTAACTGCTCGGATATCTCGAGATATCCGAGCAGTTAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001375.2-827s21c1
Sequence:CCGGCTTTGCCAAGTTCAGCAAATTCTCGAGAATTTGCTGAACTTGGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001375.2-1169s21c1
Sequence:CCGGGAAGAACTACCAGCCCTGTAACTCGAGTTACAGGGCTGGTAGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001375.2-635s21c1
Sequence:CCGGCTTCGCTCAGTTCTCGAAGATCTCGAGATCTTCGAGAACTGAGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001375
VALIDATED
DNASE2 MISSION shRNA Lentiviral Transduction Particles
deoxyribonuclease II, lysosomal
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001375.1-474s1c1
Sequence:CCGGGCTGGTCCACAGTGTACCTAACTCGAGTTAGGTACACTGTGGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001375.1-882s1c1
Sequence:CCGGGCCCTCTAACTGCTCGGATATCTCGAGATATCCGAGCAGTTAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001375.1-582s1c1
Sequence:CCGGCTTCGCTCAGTTCTCGAAGATCTCGAGATCTTCGAGAACTGAGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001375.1-774s1c1
Sequence:CCGGCTTTGCCAAGTTCAGCAAATTCTCGAGAATTTGCTGAACTTGGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001375.1-1116s1c1
Sequence:CCGGGAAGAACTACCAGCCCTGTAACTCGAGTTACAGGGCTGGTAGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001375.2-527s21c1
Sequence:CCGGGCTGGTCCACAGTGTACCTAACTCGAGTTAGGTACACTGTGGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001375.2-935s21c1
Sequence:CCGGGCCCTCTAACTGCTCGGATATCTCGAGATATCCGAGCAGTTAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001375.2-827s21c1
Sequence:CCGGCTTTGCCAAGTTCAGCAAATTCTCGAGAATTTGCTGAACTTGGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001375.2-1169s21c1
Sequence:CCGGGAAGAACTACCAGCCCTGTAACTCGAGTTACAGGGCTGGTAGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001375.2-635s21c1
Sequence:CCGGCTTCGCTCAGTTCTCGAAGATCTCGAGATCTTCGAGAACTGAGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)