EMAIL THIS PAGE TO A FRIEND

DND1

DND microRNA-mediated repression inhibitor 1

53 Gene Product Result for
Synonyms: RBMS4
UniProtKB ID: Q8IYX4
Gene ID:
Human(373863) Summary: This gene encodes a protein that binds to microRNA-targeting sequences of mRNAs, inhibiting microRNA-mediated repression. Reduced expression of this gene has been implicated in tongue squamous cell carcinoma. Two pseudogenes of this gene are located on the long arm of chromosome 17. [provided by RefSeq, Dec 2010]
Mouse(213236) dead end homolog 1 (zebrafish)
Rat(679841) DND microRNA-mediated repression inhibitor 1
Thale Cress(831393) cyclic nucleotide-gated ion channel 2
chicken(425270) dead end homolog 1 (zebrafish)
domestic cat(101097124) dead end homolog 1 (zebrafish)
cow(525516) dead end homolog 1 (zebrafish)
Horse(100061778) dead end homolog 1 (zebrafish)
dog(607141) dead end homolog 1 (zebrafish)
naked mole-rat(101711863) dead end homolog 1 (zebrafish)
domestic guinea pig(100728562) dead end homolog 1 (zebrafish)
sheep(101120240) dead end homolog 1 (zebrafish)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173383 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173383 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173383 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_194249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194249 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108081 MISSION® esiRNA esiRNA human DND1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194249 Rosetta Predictions human pricing
NM_001109379 Rosetta Predictions rat pricing
NM_173383 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371365 predicted 1270
2 SASI_Hs01_00169694 predicted 816
3 SASI_Hs01_00169695 predicted 857
4 SASI_Hs01_00169696 predicted 245
5 SASI_Hs01_00169697 predicted 1122
6 SASI_Hs01_00169698 predicted 1089
7 SASI_Hs01_00169699 predicted 577
8 SASI_Hs01_00169700 predicted 1078
9 SASI_Hs01_00169701 predicted 851
10 SASI_Hs01_00169702 predicted 951
11 SASI_Hs01_00169693 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109379 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247836 predicted 286
2 SASI_Rn02_00247837 predicted 942
3 SASI_Rn02_00247838 predicted 1014
4 SASI_Rn02_00247839 predicted 1033
5 SASI_Rn02_00247840 predicted 482
6 SASI_Rn02_00247841 predicted 577
7 SASI_Rn02_00247842 predicted 935
8 SASI_Rn02_00247843 predicted 861
9 SASI_Rn02_00247844 predicted 1238
10 SASI_Rn02_00247845 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098400 predicted 1450
2 SASI_Mm01_00098394 predicted 1272
3 SASI_Mm01_00098401 predicted 715
4 SASI_Mm01_00098395 predicted 824
5 SASI_Mm01_00098402 predicted 1414
6 SASI_Mm01_00098403 predicted 721
7 SASI_Mm02_00345201 predicted 1372
8 SASI_Mm01_00098396 predicted 1560
9 SASI_Mm02_00345202 predicted 1148
10 SASI_Mm02_00345203 predicted 974
11 SASI_Mm01_00098397 predicted 1325
12 SASI_Mm01_00098398 predicted 1575
13 SASI_Mm01_00098399 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173383
DND1 MISSION shRNA Bacterial Glycerol Stock
DND microRNA-mediated repression inhibitor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173383.2-213s21c1
Sequence:CCGGGTCAGGGTCCGAGGTGTATATCTCGAGATATACACCTCGGACCCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173383.2-477s21c1
Sequence:CCGGCGGGCTGCCTCTTAGCTTAAACTCGAGTTTAAGCTAAGAGGCAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173383.2-297s21c1
Sequence:CCGGCCTCTATGAGTTCCGCCTAATCTCGAGATTAGGCGGAACTCATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173383.2-1080s21c1
Sequence:CCGGTGAAGCAGGTACTATGGTTAACTCGAGTTAACCATAGTACCTGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173383.1-1197s1c1
Sequence:CCGGGTGTTCCTGACCAAGTGTTTACTCGAGTAAACACTTGGTCAGGAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173383.1-1416s1c1
Sequence:CCGGGAAGCAGGTACTATGGTTAAGCTCGAGCTTAACCATAGTACCTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173383.1-1659s1c1
Sequence:CCGGCAGAGCTTACTATGAATCTTTCTCGAGAAAGATTCATAGTAAGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173383.1-632s1c1
Sequence:CCGGCCTCTATGAGTTCCGCCTAATCTCGAGATTAGGCGGAACTCATAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173383
DND1 MISSION shRNA shRNA Plasmid DNA
DND microRNA-mediated repression inhibitor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173383.2-213s21c1
Sequence:CCGGGTCAGGGTCCGAGGTGTATATCTCGAGATATACACCTCGGACCCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173383.2-477s21c1
Sequence:CCGGCGGGCTGCCTCTTAGCTTAAACTCGAGTTTAAGCTAAGAGGCAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173383.2-297s21c1
Sequence:CCGGCCTCTATGAGTTCCGCCTAATCTCGAGATTAGGCGGAACTCATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173383.2-1080s21c1
Sequence:CCGGTGAAGCAGGTACTATGGTTAACTCGAGTTAACCATAGTACCTGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173383.1-1197s1c1
Sequence:CCGGGTGTTCCTGACCAAGTGTTTACTCGAGTAAACACTTGGTCAGGAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173383.1-1416s1c1
Sequence:CCGGGAAGCAGGTACTATGGTTAAGCTCGAGCTTAACCATAGTACCTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173383.1-1659s1c1
Sequence:CCGGCAGAGCTTACTATGAATCTTTCTCGAGAAAGATTCATAGTAAGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173383.1-632s1c1
Sequence:CCGGCCTCTATGAGTTCCGCCTAATCTCGAGATTAGGCGGAACTCATAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173383
DND1 MISSION shRNA Lentiviral Transduction Particles
DND microRNA-mediated repression inhibitor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173383.2-213s21c1
Sequence:CCGGGTCAGGGTCCGAGGTGTATATCTCGAGATATACACCTCGGACCCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173383.2-477s21c1
Sequence:CCGGCGGGCTGCCTCTTAGCTTAAACTCGAGTTTAAGCTAAGAGGCAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173383.2-297s21c1
Sequence:CCGGCCTCTATGAGTTCCGCCTAATCTCGAGATTAGGCGGAACTCATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173383.2-1080s21c1
Sequence:CCGGTGAAGCAGGTACTATGGTTAACTCGAGTTAACCATAGTACCTGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173383.1-1197s1c1
Sequence:CCGGGTGTTCCTGACCAAGTGTTTACTCGAGTAAACACTTGGTCAGGAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173383.1-1416s1c1
Sequence:CCGGGAAGCAGGTACTATGGTTAAGCTCGAGCTTAACCATAGTACCTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173383.1-1659s1c1
Sequence:CCGGCAGAGCTTACTATGAATCTTTCTCGAGAAAGATTCATAGTAAGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173383.1-632s1c1
Sequence:CCGGCCTCTATGAGTTCCGCCTAATCTCGAGATTAGGCGGAACTCATAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194249
DND1 MISSION shRNA Bacterial Glycerol Stock
DND microRNA-mediated repression inhibitor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-249s1c1
Sequence:CCGGGTGTACGAGCACCAGCTTATCCTCGAGGATAAGCTGGTGCTCGTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-864s1c1
Sequence:CCGGCTCACCAAGTGTTTGGGCATACTCGAGTATGCCCAAACACTTGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-582s1c1
Sequence:CCGGCAGATCGCTCTGCTCAAATTCCTCGAGGAATTTGAGCAGAGCGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-1080s1c1
Sequence:CCGGGAGGCAGGTACCATGGTTAAACTCGAGTTTAACCATGGTACCTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-774s1c1
Sequence:CCGGGCTTTGGCAAGGGACAAGTTACTCGAGTAACTTGTCCCTTGCCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-824s1c1
Sequence:CCGGGTTGCTGTGCCAACGAATGAACTCGAGTTCATTCGTTGGCACAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194249.1-1410s1c1
Sequence:CCGGGCTTAGCATGAATCTTCTTTACTCGAGTAAAGAAGATTCATGCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-1084s1c1
Sequence:CCGGCAGGTACCATGGTTAAACAGTCTCGAGACTGTTTAACCATGGTACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194249.1-1405s1c1
Sequence:CCGGCCACAGCTTAGCATGAATCTTCTCGAGAAGATTCATGCTAAGCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194249.1-1404s1c1
Sequence:CCGGGCCACAGCTTAGCATGAATCTCTCGAGAGATTCATGCTAAGCTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194249
DND1 MISSION shRNA shRNA Plasmid DNA
DND microRNA-mediated repression inhibitor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-249s1c1
Sequence:CCGGGTGTACGAGCACCAGCTTATCCTCGAGGATAAGCTGGTGCTCGTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-864s1c1
Sequence:CCGGCTCACCAAGTGTTTGGGCATACTCGAGTATGCCCAAACACTTGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-582s1c1
Sequence:CCGGCAGATCGCTCTGCTCAAATTCCTCGAGGAATTTGAGCAGAGCGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-1080s1c1
Sequence:CCGGGAGGCAGGTACCATGGTTAAACTCGAGTTTAACCATGGTACCTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-774s1c1
Sequence:CCGGGCTTTGGCAAGGGACAAGTTACTCGAGTAACTTGTCCCTTGCCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-824s1c1
Sequence:CCGGGTTGCTGTGCCAACGAATGAACTCGAGTTCATTCGTTGGCACAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194249.1-1410s1c1
Sequence:CCGGGCTTAGCATGAATCTTCTTTACTCGAGTAAAGAAGATTCATGCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-1084s1c1
Sequence:CCGGCAGGTACCATGGTTAAACAGTCTCGAGACTGTTTAACCATGGTACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194249.1-1405s1c1
Sequence:CCGGCCACAGCTTAGCATGAATCTTCTCGAGAAGATTCATGCTAAGCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194249.1-1404s1c1
Sequence:CCGGGCCACAGCTTAGCATGAATCTCTCGAGAGATTCATGCTAAGCTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194249
DND1 MISSION shRNA Lentiviral Transduction Particles
DND microRNA-mediated repression inhibitor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-249s1c1
Sequence:CCGGGTGTACGAGCACCAGCTTATCCTCGAGGATAAGCTGGTGCTCGTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-864s1c1
Sequence:CCGGCTCACCAAGTGTTTGGGCATACTCGAGTATGCCCAAACACTTGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-582s1c1
Sequence:CCGGCAGATCGCTCTGCTCAAATTCCTCGAGGAATTTGAGCAGAGCGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-1080s1c1
Sequence:CCGGGAGGCAGGTACCATGGTTAAACTCGAGTTTAACCATGGTACCTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-774s1c1
Sequence:CCGGGCTTTGGCAAGGGACAAGTTACTCGAGTAACTTGTCCCTTGCCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-824s1c1
Sequence:CCGGGTTGCTGTGCCAACGAATGAACTCGAGTTCATTCGTTGGCACAGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194249.1-1410s1c1
Sequence:CCGGGCTTAGCATGAATCTTCTTTACTCGAGTAAAGAAGATTCATGCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194249.1-1084s1c1
Sequence:CCGGCAGGTACCATGGTTAAACAGTCTCGAGACTGTTTAACCATGGTACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188054    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194249.1-1405s1c1
Sequence:CCGGCCACAGCTTAGCATGAATCTTCTCGAGAAGATTCATGCTAAGCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194249.1-1404s1c1
Sequence:CCGGGCCACAGCTTAGCATGAATCTCTCGAGAGATTCATGCTAAGCTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)