EMAIL THIS PAGE TO A FRIEND

DNER

delta/notch-like EGF repeat containing

100 Gene Product Result for
Synonyms: UNQ26 bet
Gene ID:
Mouse(227325) delta/notch-like EGF-related receptor
Rat(316573) delta/notch-like EGF repeat containing
Zebrafish(102060347) delta/notch-like EGF repeat containing
cow(516825) delta/notch-like EGF repeat containing
cow(540552) delta and Notch-like epidermal growth factor-related receptor-like
cow(100337005) delta/notch-like EGF repeat containing
Horse(100063115) delta/notch-like EGF repeat containing
domestic cat(101092957) delta/notch-like EGF repeat containing
dog(609904) delta/notch-like EGF repeat containing
Zebrafish(100332110) delta/notch-like EGF repeat containing
chicken(424786) delta/notch-like EGF repeat containing
sheep(101119703) delta/notch-like EGF repeat containing
domestic guinea pig(100729668) delta/notch-like EGF repeat containing
naked mole-rat(101719360) delta/notch-like EGF repeat containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1417 Human DNER ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139072 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152915 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152915 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152915 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139072 Rosetta Predictions human pricing
XM_001064351 Rosetta Predictions rat pricing
XM_001077059 Rosetta Predictions rat pricing
NM_152915 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102740 predicted 2088
2 SASI_Hs01_00102741 predicted 791
3 SASI_Hs01_00102742 predicted 1488
4 SASI_Hs01_00102743 predicted 1006
5 SASI_Hs01_00102744 predicted 2342
6 SASI_Hs01_00102745 predicted 1881
7 SASI_Hs01_00102747 predicted 2290
8 SASI_Hs01_00102748 predicted 800
9 SASI_Hs01_00102749 predicted 999
10 SASI_Hs02_00364129 predicted 737
11 SASI_Hs01_00102746 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310131 predicted 1601
2 SASI_Rn02_00310132 predicted 1598
3 SASI_Rn02_00310133 predicted 214
4 SASI_Rn02_00310134 predicted 544
5 SASI_Rn02_00310135 predicted 326
6 SASI_Rn02_00310136 predicted 925
7 SASI_Rn02_00310137 predicted 713
8 SASI_Rn02_00310138 predicted 1684
9 SASI_Rn02_00310139 predicted 704
10 SASI_Rn02_00310140 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355609 predicted 968
2 SASI_Rn02_00355610 predicted 564
3 SASI_Rn02_00355611 predicted 918
4 SASI_Rn02_00355612 predicted 677
5 SASI_Rn02_00355613 predicted 543
6 SASI_Rn02_00355614 predicted 581
7 SASI_Rn02_00355615 predicted 592
8 SASI_Rn02_00355616 predicted 707
9 SASI_Rn02_00355617 predicted 658
10 SASI_Rn02_00355618 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045967 predicted 1649
2 SASI_Mm01_00045968 predicted 1353
3 SASI_Mm01_00045969 predicted 1342
4 SASI_Mm01_00045970 predicted 2093
5 SASI_Mm01_00045971 predicted 1577
6 SASI_Mm01_00045972 predicted 2131
7 SASI_Mm01_00045973 predicted 1552
8 SASI_Mm01_00045974 predicted 1513
9 SASI_Mm01_00045975 predicted 2223
10 SASI_Mm01_00045976 predicted 1662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139072
DNER MISSION shRNA Bacterial Glycerol Stock
delta/notch-like EGF repeat containing
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139072.2-729s1c1
Sequence:CCGGCCAGATATTGCCTGTGGGAATCTCGAGATTCCCACAGGCAATATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139072.2-1392s1c1
Sequence:CCGGCCAGAAGGATACTTCGGATCTCTCGAGAGATCCGAAGTATCCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139072.2-1729s1c1
Sequence:CCGGGCCTGGCAGAATACAAAGGAACTCGAGTTCCTTTGTATTCTGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139072.2-2134s1c1
Sequence:CCGGGCATTGAATACCAGGGTTCTTCTCGAGAAGAACCCTGGTATTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139072.2-1221s1c1
Sequence:CCGGGCGAGCTGTATTGATGCAAATCTCGAGATTTGCATCAATACAGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139072.2-2852s1c1
Sequence:CCGGCCTTATTCTGTGCATGGGTAACTCGAGTTACCCATGCACAGAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139072.2-1004s1c1
Sequence:CCGGGACTAAGTCTATTGTGGCTTTCTCGAGAAAGCCACAATAGACTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139072.2-2994s1c1
Sequence:CCGGCGAGGCAAATTCTGATTGATTCTCGAGAATCAATCAGAATTTGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139072.2-2626s1c1
Sequence:CCGGCCCAGATTAATTTCTGTGGTTCTCGAGAACCACAGAAATTAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139072.2-2993s1c1
Sequence:CCGGGCGAGGCAAATTCTGATTGATCTCGAGATCAATCAGAATTTGCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139072
DNER MISSION shRNA shRNA Plasmid DNA
delta/notch-like EGF repeat containing
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139072.2-729s1c1
Sequence:CCGGCCAGATATTGCCTGTGGGAATCTCGAGATTCCCACAGGCAATATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139072.2-1392s1c1
Sequence:CCGGCCAGAAGGATACTTCGGATCTCTCGAGAGATCCGAAGTATCCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139072.2-1729s1c1
Sequence:CCGGGCCTGGCAGAATACAAAGGAACTCGAGTTCCTTTGTATTCTGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139072.2-2134s1c1
Sequence:CCGGGCATTGAATACCAGGGTTCTTCTCGAGAAGAACCCTGGTATTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139072.2-1221s1c1
Sequence:CCGGGCGAGCTGTATTGATGCAAATCTCGAGATTTGCATCAATACAGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139072.2-2852s1c1
Sequence:CCGGCCTTATTCTGTGCATGGGTAACTCGAGTTACCCATGCACAGAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139072.2-1004s1c1
Sequence:CCGGGACTAAGTCTATTGTGGCTTTCTCGAGAAAGCCACAATAGACTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139072.2-2994s1c1
Sequence:CCGGCGAGGCAAATTCTGATTGATTCTCGAGAATCAATCAGAATTTGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139072.2-2626s1c1
Sequence:CCGGCCCAGATTAATTTCTGTGGTTCTCGAGAACCACAGAAATTAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139072.2-2993s1c1
Sequence:CCGGGCGAGGCAAATTCTGATTGATCTCGAGATCAATCAGAATTTGCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139072
DNER MISSION shRNA Lentiviral Transduction Particles
delta/notch-like EGF repeat containing
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139072.2-729s1c1
Sequence:CCGGCCAGATATTGCCTGTGGGAATCTCGAGATTCCCACAGGCAATATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139072.2-1392s1c1
Sequence:CCGGCCAGAAGGATACTTCGGATCTCTCGAGAGATCCGAAGTATCCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139072.2-1729s1c1
Sequence:CCGGGCCTGGCAGAATACAAAGGAACTCGAGTTCCTTTGTATTCTGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139072.2-2134s1c1
Sequence:CCGGGCATTGAATACCAGGGTTCTTCTCGAGAAGAACCCTGGTATTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139072.2-1221s1c1
Sequence:CCGGGCGAGCTGTATTGATGCAAATCTCGAGATTTGCATCAATACAGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139072.2-2852s1c1
Sequence:CCGGCCTTATTCTGTGCATGGGTAACTCGAGTTACCCATGCACAGAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139072.2-1004s1c1
Sequence:CCGGGACTAAGTCTATTGTGGCTTTCTCGAGAAAGCCACAATAGACTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139072.2-2994s1c1
Sequence:CCGGCGAGGCAAATTCTGATTGATTCTCGAGAATCAATCAGAATTTGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139072.2-2626s1c1
Sequence:CCGGCCCAGATTAATTTCTGTGGTTCTCGAGAACCACAGAAATTAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139072.2-2993s1c1
Sequence:CCGGGCGAGGCAAATTCTGATTGATCTCGAGATCAATCAGAATTTGCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152915
DNER MISSION shRNA Bacterial Glycerol Stock
delta/notch-like EGF repeat containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152915.1-2884s1c1
Sequence:CCGGCCAGAATTTGTGAAATCCGTACTCGAGTACGGATTTCACAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152915.1-1577s1c1
Sequence:CCGGGCGAGCTGTATTGATGCAAATCTCGAGATTTGCATCAATACAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152915.1-865s1c1
Sequence:CCGGCGACGGCTATGAAGGTCTTAACTCGAGTTAAGACCTTCATAGCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152915.1-2085s1c1
Sequence:CCGGGCCTGGCAGAATATAAAGGAACTCGAGTTCCTTTATATTCTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152915.1-1638s1c1
Sequence:CCGGCAGGTTATACTGGAGAGCTTTCTCGAGAAAGCTCTCCAGTATAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152915
DNER MISSION shRNA shRNA Plasmid DNA
delta/notch-like EGF repeat containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152915.1-2884s1c1
Sequence:CCGGCCAGAATTTGTGAAATCCGTACTCGAGTACGGATTTCACAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152915.1-1577s1c1
Sequence:CCGGGCGAGCTGTATTGATGCAAATCTCGAGATTTGCATCAATACAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152915.1-865s1c1
Sequence:CCGGCGACGGCTATGAAGGTCTTAACTCGAGTTAAGACCTTCATAGCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152915.1-2085s1c1
Sequence:CCGGGCCTGGCAGAATATAAAGGAACTCGAGTTCCTTTATATTCTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152915.1-1638s1c1
Sequence:CCGGCAGGTTATACTGGAGAGCTTTCTCGAGAAAGCTCTCCAGTATAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152915
DNER MISSION shRNA Lentiviral Transduction Particles
delta/notch-like EGF repeat containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152915.1-2884s1c1
Sequence:CCGGCCAGAATTTGTGAAATCCGTACTCGAGTACGGATTTCACAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152915.1-1577s1c1
Sequence:CCGGGCGAGCTGTATTGATGCAAATCTCGAGATTTGCATCAATACAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152915.1-865s1c1
Sequence:CCGGCGACGGCTATGAAGGTCTTAACTCGAGTTAAGACCTTCATAGCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152915.1-2085s1c1
Sequence:CCGGGCCTGGCAGAATATAAAGGAACTCGAGTTCCTTTATATTCTGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152915.1-1638s1c1
Sequence:CCGGCAGGTTATACTGGAGAGCTTTCTCGAGAAAGCTCTCCAGTATAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks