EMAIL THIS PAGE TO A FRIEND

DNHD1

dynein heavy chain domain 1

242 Gene Product Result for
Synonyms: C11orf47 CCDC35 DHCD1 DNHD1L
UniProtKB ID: Q96M86, Q2NKK8, Q6UWI9, Q8NAA2, Q8TEE6, Q9NSZ9
Gene ID:
Mouse(77505) dynein heavy chain domain 1
Rat(690108) dynein heavy chain domain 1
cow(617229) dynein heavy chain domain 1
domestic cat(101099999) dynein heavy chain domain 1
dog(611003) dynein heavy chain domain 1
dog(485335) dynein heavy chain domain 1
naked mole-rat(101724986) dynein heavy chain domain 1
domestic guinea pig(100719202) dynein heavy chain domain 1
sheep(101110446) dynein heavy chain domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144666 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144666 Rosetta Predictions human pricing
XM_001073288 Rosetta Predictions rat pricing
XM_908793 Rosetta Predictions mouse pricing
XM_983220 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060554 predicted 1486
2 SASI_Hs01_00060555 predicted 647
3 SASI_Hs01_00060556 predicted 2532
4 SASI_Hs01_00060558 predicted 749
5 SASI_Hs01_00060559 predicted 1330
6 SASI_Hs01_00060560 predicted 383
7 SASI_Hs01_00060561 predicted 2908
8 SASI_Hs01_00060562 predicted 2543
9 SASI_Hs01_00060563 predicted 1952
10 SASI_Hs02_00364555 predicted 610
11 SASI_Hs01_00060557 predicted 1953
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342235 predicted 996
2 SASI_Rn02_00342236 predicted 288
3 SASI_Rn02_00342237 predicted 2577
4 SASI_Rn02_00342238 predicted 937
5 SASI_Rn02_00342239 predicted 627
6 SASI_Rn02_00342240 predicted 273
7 SASI_Rn02_00342241 predicted 2852
8 SASI_Rn02_00342242 predicted 228
9 SASI_Rn02_00342243 predicted 1114
10 SASI_Rn02_00342244 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206758 predicted 9266
2 SASI_Mm01_00206759 predicted 9440
3 SASI_Mm01_00206760 predicted 5800
4 SASI_Mm02_00434392 predicted 7470
5 SASI_Mm01_00206761 predicted 8721
6 SASI_Mm01_00206763 predicted 9235
7 SASI_Mm01_00206764 predicted 4401
8 SASI_Mm01_00206765 predicted 5076
9 SASI_Mm01_00206767 predicted 2631
10 SASI_Mm02_00434393 predicted 2974
11 SASI_Mm01_00206762 predicted 11857
12 SASI_Mm01_00206766 predicted 11616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_983220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448066 predicted 4185
2 SASI_Mm02_00448067 predicted 5806
3 SASI_Mm02_00448068 predicted 3678
4 SASI_Mm02_00448069 predicted 6007
5 SASI_Mm02_00448070 predicted 4401
6 SASI_Mm02_00448071 predicted 5072
7 SASI_Mm02_00448072 predicted 2623
8 SASI_Mm02_00448073 predicted 5523
9 SASI_Mm02_00448074 predicted 2971
10 SASI_Mm02_00448075 predicted 6266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144666
DNHD1 MISSION shRNA Bacterial Glycerol Stock
dynein heavy chain domain 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1040s1c1
Sequence:CCGGCCTGGCATGAATGTGAGATGTCTCGAGACATCTCACATTCATGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1951s1c1
Sequence:CCGGCAAGTGACTCTAACCCAGGTTCTCGAGAACCTGGGTTAGAGTCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-574s1c1
Sequence:CCGGGCTCATTGTGAAGAGTTAGAACTCGAGTTCTAACTCTTCACAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-2760s1c1
Sequence:CCGGGCAACTGTTGGTTCGTTACTTCTCGAGAAGTAACGAACCAACAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1315s1c1
Sequence:CCGGCCCTTTAAACATAGTCAGGCTCTCGAGAGCCTGACTATGTTTAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1393s1c1
Sequence:CCGGCCTCTGACTGTCATCCAGAAACTCGAGTTTCTGGATGACAGTCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-520s1c1
Sequence:CCGGGCCAAGTTTCTGCGGAACATACTCGAGTATGTTCCGCAGAAACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1624s1c1
Sequence:CCGGGTTGCAGACCTGGAATCAGAACTCGAGTTCTGATTCCAGGTCTGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1943s1c1
Sequence:CCGGGCTGGAGTCAAGTGACTCTAACTCGAGTTAGAGTCACTTGACTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-418s1c1
Sequence:CCGGGACCTAAAGATCAGAGCCCTACTCGAGTAGGGCTCTGATCTTTAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144666
DNHD1 MISSION shRNA shRNA Plasmid DNA
dynein heavy chain domain 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1040s1c1
Sequence:CCGGCCTGGCATGAATGTGAGATGTCTCGAGACATCTCACATTCATGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1951s1c1
Sequence:CCGGCAAGTGACTCTAACCCAGGTTCTCGAGAACCTGGGTTAGAGTCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-574s1c1
Sequence:CCGGGCTCATTGTGAAGAGTTAGAACTCGAGTTCTAACTCTTCACAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-2760s1c1
Sequence:CCGGGCAACTGTTGGTTCGTTACTTCTCGAGAAGTAACGAACCAACAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1315s1c1
Sequence:CCGGCCCTTTAAACATAGTCAGGCTCTCGAGAGCCTGACTATGTTTAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1393s1c1
Sequence:CCGGCCTCTGACTGTCATCCAGAAACTCGAGTTTCTGGATGACAGTCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-520s1c1
Sequence:CCGGGCCAAGTTTCTGCGGAACATACTCGAGTATGTTCCGCAGAAACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1624s1c1
Sequence:CCGGGTTGCAGACCTGGAATCAGAACTCGAGTTCTGATTCCAGGTCTGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1943s1c1
Sequence:CCGGGCTGGAGTCAAGTGACTCTAACTCGAGTTAGAGTCACTTGACTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-418s1c1
Sequence:CCGGGACCTAAAGATCAGAGCCCTACTCGAGTAGGGCTCTGATCTTTAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144666
DNHD1 MISSION shRNA Lentiviral Transduction Particles
dynein heavy chain domain 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1040s1c1
Sequence:CCGGCCTGGCATGAATGTGAGATGTCTCGAGACATCTCACATTCATGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1951s1c1
Sequence:CCGGCAAGTGACTCTAACCCAGGTTCTCGAGAACCTGGGTTAGAGTCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-574s1c1
Sequence:CCGGGCTCATTGTGAAGAGTTAGAACTCGAGTTCTAACTCTTCACAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-2760s1c1
Sequence:CCGGGCAACTGTTGGTTCGTTACTTCTCGAGAAGTAACGAACCAACAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1315s1c1
Sequence:CCGGCCCTTTAAACATAGTCAGGCTCTCGAGAGCCTGACTATGTTTAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1393s1c1
Sequence:CCGGCCTCTGACTGTCATCCAGAAACTCGAGTTTCTGGATGACAGTCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-520s1c1
Sequence:CCGGGCCAAGTTTCTGCGGAACATACTCGAGTATGTTCCGCAGAAACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1624s1c1
Sequence:CCGGGTTGCAGACCTGGAATCAGAACTCGAGTTCTGATTCCAGGTCTGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-1943s1c1
Sequence:CCGGGCTGGAGTCAAGTGACTCTAACTCGAGTTAGAGTCACTTGACTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144666.1-418s1c1
Sequence:CCGGGACCTAAAGATCAGAGCCCTACTCGAGTAGGGCTCTGATCTTTAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)