EMAIL THIS PAGE TO A FRIEND

DNLZ

DNL-type zinc finger

60 Gene Product Result for
Synonyms: C9orf151 HEP HEP1 TIMM15 ZIM17 bA413M3.2
UniProtKB ID: Q5SXM8, B2RUX5, B9EJE1
Gene ID:
Mouse(52838) DNL-type zinc finger
Rat(296587) DNL-type zinc finger
chicken(772152) DNL-type zinc finger
dog(607502) DNL-type zinc finger
domestic cat(101092900) DNL-type zinc finger
cow(100848156) DNL-type zinc finger
domestic guinea pig(100723468) DNL-type zinc finger
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080849 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001139503 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001139503 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001139503 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080849 Rosetta Predictions human pricing
NM_001130990 Rosetta Predictions rat pricing
NR_024073 Rosetta Predictions rat pricing
XM_216011 Rosetta Predictions rat pricing
NM_026828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316127 predicted 468
2 SASI_Hs02_00316128 predicted 463
3 SASI_Hs02_00316129 predicted 420
4 SASI_Hs02_00316130 predicted 274
5 SASI_Hs02_00316131 predicted 335
6 SASI_Hs02_00316132 predicted 397
7 SASI_Hs02_00316133 predicted 627
8 SASI_Hs02_00316134 predicted 271
9 SASI_Hs02_00316135 predicted 317
10 SASI_Hs02_00316136 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256099 predicted 264
2 SASI_Rn02_00256100 predicted 291
3 SASI_Rn02_00256101 predicted 318
4 SASI_Rn02_00256102 predicted 341
5 SASI_Rn02_00256103 predicted 321
6 SASI_Rn02_00256104 predicted 369
7 SASI_Rn02_00256105 predicted 375
8 SASI_Rn02_00256106 predicted 403
9 SASI_Rn02_00256107 predicted 357
10 SASI_Rn02_00256108 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_024073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270791 predicted 257
2 SASI_Rn02_00270792 predicted 365
3 SASI_Rn02_00270793 predicted 386
4 SASI_Rn02_00270794 predicted 358
5 SASI_Rn02_00270795 predicted 330
6 SASI_Rn02_00270796 predicted 415
7 SASI_Rn02_00270797 predicted 422
8 SASI_Rn02_00270798 predicted 450
9 SASI_Rn02_00270799 predicted 399
10 SASI_Rn02_00270800 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174386 predicted 334
2 SASI_Rn01_00174387 predicted 365
3 SASI_Rn01_00174388 predicted 391
4 SASI_Rn01_00174389 predicted 414
5 SASI_Rn01_00174390 predicted 391
6 SASI_Rn01_00174391 predicted 531
7 SASI_Rn01_00174392 predicted 446
8 SASI_Rn01_00174393 predicted 447
9 SASI_Rn01_00174394 predicted 478
10 SASI_Rn01_00174395 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330990 predicted 297
2 SASI_Mm02_00330991 predicted 647
3 SASI_Mm02_00330992 predicted 611
4 SASI_Mm02_00330993 predicted 373
5 SASI_Mm02_00330994 predicted 314
6 SASI_Mm02_00330995 predicted 436
7 SASI_Mm02_00330996 predicted 302
8 SASI_Mm02_00330997 predicted 405
9 SASI_Mm02_00330998 predicted 433
10 SASI_Mm02_00330999 predicted 425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080849
VALIDATED
DNLZ MISSION shRNA Bacterial Glycerol Stock
DNL-type zinc finger
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080849.1-347s21c1
Sequence:CCGGATCACCAAGGCGTGGTCATTGCTCGAGCAATGACCACGCCTTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080849.1-278s21c1
Sequence:CCGGACTACCAGCTCGTCTACACCTCTCGAGAGGTGTAGACGAGCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080849.1-438s21c1
Sequence:CCGGGAAGAGAAATATCGAAGAGATCTCGAGATCTCTTCGATATTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080849.1-381s21c1
Sequence:CCGGCTGCCAGAACCACCATATCATCTCGAGATGATATGGTGGTTCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080849.1-416s21c1
Sequence:CCGGGCTGGTTCTCGGACCTGAATGCTCGAGCATTCAGGTCCGAGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080849
VALIDATED
DNLZ MISSION shRNA shRNA Plasmid DNA
DNL-type zinc finger
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080849.1-347s21c1
Sequence:CCGGATCACCAAGGCGTGGTCATTGCTCGAGCAATGACCACGCCTTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080849.1-278s21c1
Sequence:CCGGACTACCAGCTCGTCTACACCTCTCGAGAGGTGTAGACGAGCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080849.1-438s21c1
Sequence:CCGGGAAGAGAAATATCGAAGAGATCTCGAGATCTCTTCGATATTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080849.1-381s21c1
Sequence:CCGGCTGCCAGAACCACCATATCATCTCGAGATGATATGGTGGTTCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080849.1-416s21c1
Sequence:CCGGGCTGGTTCTCGGACCTGAATGCTCGAGCATTCAGGTCCGAGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080849
VALIDATED
DNLZ MISSION shRNA Lentiviral Transduction Particles
DNL-type zinc finger
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080849.1-347s21c1
Sequence:CCGGATCACCAAGGCGTGGTCATTGCTCGAGCAATGACCACGCCTTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080849.1-278s21c1
Sequence:CCGGACTACCAGCTCGTCTACACCTCTCGAGAGGTGTAGACGAGCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080849.1-438s21c1
Sequence:CCGGGAAGAGAAATATCGAAGAGATCTCGAGATCTCTTCGATATTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080849.1-381s21c1
Sequence:CCGGCTGCCAGAACCACCATATCATCTCGAGATGATATGGTGGTTCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080849.1-416s21c1
Sequence:CCGGGCTGGTTCTCGGACCTGAATGCTCGAGCATTCAGGTCCGAGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001139503
DNLZ MISSION shRNA Bacterial Glycerol Stock
DNL-type zinc finger
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001139503.1-2330s21c1
Sequence:CCGGGCATAATCCAGCGCTTGTAATCTCGAGATTACAAGCGCTGGATTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139503.1-195s21c1
Sequence:CCGGCTAAAGACCGCGGAGAGACTTCTCGAGAAGTCTCTCCGCGGTCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139503.1-300s21c1
Sequence:CCGGGTGGAAGCGGACCACTATCAACTCGAGTTGATAGTGGTCCGCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139503.1-131s21c1
Sequence:CCGGACTACTTCGTAGTGTGCGGACCTCGAGGTCCGCACACTACGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139503.1-326s21c1
Sequence:CCGGCTACACCTGCAAGGAATATTGCTCGAGCAATATTCCTTGCAGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001139503
DNLZ MISSION shRNA shRNA Plasmid DNA
DNL-type zinc finger
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001139503.1-2330s21c1
Sequence:CCGGGCATAATCCAGCGCTTGTAATCTCGAGATTACAAGCGCTGGATTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139503.1-195s21c1
Sequence:CCGGCTAAAGACCGCGGAGAGACTTCTCGAGAAGTCTCTCCGCGGTCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139503.1-300s21c1
Sequence:CCGGGTGGAAGCGGACCACTATCAACTCGAGTTGATAGTGGTCCGCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139503.1-131s21c1
Sequence:CCGGACTACTTCGTAGTGTGCGGACCTCGAGGTCCGCACACTACGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139503.1-326s21c1
Sequence:CCGGCTACACCTGCAAGGAATATTGCTCGAGCAATATTCCTTGCAGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001139503
DNLZ MISSION shRNA Lentiviral Transduction Particles
DNL-type zinc finger
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001139503.1-2330s21c1
Sequence:CCGGGCATAATCCAGCGCTTGTAATCTCGAGATTACAAGCGCTGGATTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139503.1-195s21c1
Sequence:CCGGCTAAAGACCGCGGAGAGACTTCTCGAGAAGTCTCTCCGCGGTCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139503.1-300s21c1
Sequence:CCGGGTGGAAGCGGACCACTATCAACTCGAGTTGATAGTGGTCCGCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139503.1-131s21c1
Sequence:CCGGACTACTTCGTAGTGTGCGGACCTCGAGGTCCGCACACTACGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139503.1-326s21c1
Sequence:CCGGCTACACCTGCAAGGAATATTGCTCGAGCAATATTCCTTGCAGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks