EMAIL THIS PAGE TO A FRIEND

DNM1

dynamin 1

Synonyms: DNM
UniProtKB ID: Q05193, A6NLM6, Q5SYX0, Q5SYX2, Q6P3T6, Q86VD2
Gene ID:
Human(1759) Summary: This gene encodes a member of the dynamin subfamily of GTP-binding proteins. The encoded protein possesses unique mechanochemical properties used to tubulate and sever membranes, and is involved in clathrin-mediated endocytosis and other vesicular trafficking processes. Actin and other cytoskeletal proteins act as binding partners for the encoded protein, which can also self-assemble leading to stimulation of GTPase activity. More than sixty highly conserved copies of the 3' region of this gene are found elsewhere in the genome, particularly on chromosomes Y and 15. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(13429) dynamin 1
Rat(140694) dynamin 1
sheep(101108737) dynamin 1
chicken(417217) dynamin 1
dog(491319) dynamin 1
cow(508794) dynamin 1
Horse(100070282) dynamin 1
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100611 Anti-DNM1 antibody produced in rabbit affinity isolated antibody bovine, canine, rat, guinea pig, mouse, horse, human
western blot pricing
HPA049910 Anti-DNM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4500661 Anti-Dynamin-1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4504664 Anti-phospho-DYN1 (pSer778) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
P1997 Anti-phospho-Dynamin (pSer774) antibody produced in sheep affinity isolated antibody, aqueous glycerol suspension mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
P2122 Anti-phospho-Dynamin (pSer778) antibody produced in sheep affinity isolated antibody, aqueous glycerol suspension rat, mouse, human
western blot pricing
SAB4503866 Anti-phospho-Dynamin-1 (pSer774) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301501 Anti-phospho-Dynamin-1 (pSer774) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB5300111 Monoclonal Anti-DNM1 antibody produced in mouse clone 3G4B6, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010065 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010065 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010065 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004408 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU076161 MISSION® esiRNA esiRNA targeting mouse Dnm1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005336 Rosetta Predictions human pricing
NM_004408 Rosetta Predictions human pricing
NM_080689 Rosetta Predictions rat pricing
NM_010065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304850 predicted 1248
2 SASI_Hs01_00189738 predicted 1628
3 SASI_Hs01_00189739 predicted 1194
4 SASI_Hs01_00189740 predicted 1386
5 SASI_Hs01_00189741 predicted 436
6 SASI_Hs01_00189742 predicted 554
7 SASI_Hs01_00189744 predicted 1659
8 SASI_Hs01_00189745 predicted 1123
9 SASI_Hs01_00189746 predicted 248
10 SASI_Hs01_00189747 predicted 1719
11 SASI_Hs01_00189743 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337546 predicted 1248
2 SASI_Hs01_00211638 predicted 1634
3 SASI_Hs01_00211639 predicted 1198
4 SASI_Hs01_00211640 predicted 1386
5 SASI_Hs01_00211641 predicted 437
6 SASI_Hs01_00211642 predicted 551
7 SASI_Hs01_00211644 predicted 1660
8 SASI_Hs01_00211645 predicted 1126
9 SASI_Hs01_00211646 predicted 244
10 SASI_Hs01_00211647 predicted 1725
11 SASI_Hs01_00211643 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267265 predicted 2048
2 SASI_Rn02_00267266 predicted 527
3 SASI_Rn02_00267267 predicted 255
4 SASI_Rn02_00267268 predicted 1685
5 SASI_Rn02_00267269 predicted 733
6 SASI_Rn02_00267270 predicted 1315
7 SASI_Rn02_00267271 predicted 522
8 SASI_Rn02_00267272 predicted 1513
9 SASI_Rn02_00267273 predicted 1126
10 SASI_Rn02_00267274 predicted 1837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159427 predicted 1316
2 SASI_Mm01_00159428 predicted 1385
3 SASI_Mm02_00317737 predicted 434
4 SASI_Mm01_00159430 predicted 1719
5 SASI_Mm01_00159432 predicted 1402
6 SASI_Mm01_00159433 predicted 1171
7 SASI_Mm01_00159434 predicted 427
8 SASI_Mm01_00159436 predicted 566
9 SASI_Mm02_00317738 predicted 1361
10 SASI_Mm02_00317739 predicted 1867
11 SASI_Mm01_00159429 predicted 2099
12 SASI_Mm01_00159431 predicted 287
13 SASI_Mm01_00159435 predicted 1844
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010065
VALIDATED
DNM1 MISSION shRNA Bacterial Glycerol Stock
dynamin 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010065.2-573s21c1
Sequence:GTACCGGCTTATGCAGTTCGTCACTAAGCTCGAGCTTAGTGACGAACTGCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010065.2-1519s21c1
Sequence:GTACCGGTCATGCTTCTCATCGACATTGCTCGAGCAATGTCGATGAGAAGCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010065.2-1317s21c1
Sequence:CCGGGCCTTTGAAACCATTGTGAAACTCGAGTTTCACAATGGTTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010065.2-1819s21c1
Sequence:CCGGTCATGTCAAGCAAGCATATTTCTCGAGAAATATGCTTGCTTGACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010065.2-2995s21c1
Sequence:CCGGCTCAGACTACCTGCTAGTTACCTCGAGGTAACTAGCAGGTAGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010065.2-848s21c1
Sequence:CCGGCTTGGCTGCAGAGCGCAAATTCTCGAGAATTTGCGCTCTGCAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010065.2-2297s21c1
Sequence:CCGGGCTCAGTATTATCGGCGACATCTCGAGATGTCGCCGATAATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010065.1-3414s1c1
Sequence:CCGGCCTGCGACATTCTATAAATATCTCGAGATATTTATAGAATGTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010065.1-1295s1c1
Sequence:CCGGGCCTTTGAAACCATTGTGAAACTCGAGTTTCACAATGGTTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010065.1-1795s1c1
Sequence:CCGGCTTCATGTCAAGCAAGCATATCTCGAGATATGCTTGCTTGACATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010065.1-2275s1c1
Sequence:CCGGGCTCAGTATTATCGGCGACATCTCGAGATGTCGCCGATAATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010065.1-550s1c1
Sequence:CCGGGCTTATGCAGTTCGTCACTAACTCGAGTTAGTGACGAACTGCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010065
VALIDATED
DNM1 MISSION shRNA shRNA Plasmid DNA
dynamin 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010065.2-573s21c1
Sequence:GTACCGGCTTATGCAGTTCGTCACTAAGCTCGAGCTTAGTGACGAACTGCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010065.2-1519s21c1
Sequence:GTACCGGTCATGCTTCTCATCGACATTGCTCGAGCAATGTCGATGAGAAGCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010065.2-1317s21c1
Sequence:CCGGGCCTTTGAAACCATTGTGAAACTCGAGTTTCACAATGGTTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010065.2-1819s21c1
Sequence:CCGGTCATGTCAAGCAAGCATATTTCTCGAGAAATATGCTTGCTTGACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010065.2-2995s21c1
Sequence:CCGGCTCAGACTACCTGCTAGTTACCTCGAGGTAACTAGCAGGTAGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010065.2-848s21c1
Sequence:CCGGCTTGGCTGCAGAGCGCAAATTCTCGAGAATTTGCGCTCTGCAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010065.2-2297s21c1
Sequence:CCGGGCTCAGTATTATCGGCGACATCTCGAGATGTCGCCGATAATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010065.1-3414s1c1
Sequence:CCGGCCTGCGACATTCTATAAATATCTCGAGATATTTATAGAATGTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010065.1-1295s1c1
Sequence:CCGGGCCTTTGAAACCATTGTGAAACTCGAGTTTCACAATGGTTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010065.1-1795s1c1
Sequence:CCGGCTTCATGTCAAGCAAGCATATCTCGAGATATGCTTGCTTGACATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010065.1-2275s1c1
Sequence:CCGGGCTCAGTATTATCGGCGACATCTCGAGATGTCGCCGATAATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010065.1-550s1c1
Sequence:CCGGGCTTATGCAGTTCGTCACTAACTCGAGTTAGTGACGAACTGCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010065
VALIDATED
DNM1 MISSION shRNA Lentiviral Transduction Particles
dynamin 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010065.2-573s21c1
Sequence:GTACCGGCTTATGCAGTTCGTCACTAAGCTCGAGCTTAGTGACGAACTGCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010065.2-1519s21c1
Sequence:GTACCGGTCATGCTTCTCATCGACATTGCTCGAGCAATGTCGATGAGAAGCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010065.2-1317s21c1
Sequence:CCGGGCCTTTGAAACCATTGTGAAACTCGAGTTTCACAATGGTTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010065.2-1819s21c1
Sequence:CCGGTCATGTCAAGCAAGCATATTTCTCGAGAAATATGCTTGCTTGACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010065.2-2995s21c1
Sequence:CCGGCTCAGACTACCTGCTAGTTACCTCGAGGTAACTAGCAGGTAGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010065.2-848s21c1
Sequence:CCGGCTTGGCTGCAGAGCGCAAATTCTCGAGAATTTGCGCTCTGCAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010065.2-2297s21c1
Sequence:CCGGGCTCAGTATTATCGGCGACATCTCGAGATGTCGCCGATAATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010065.1-3414s1c1
Sequence:CCGGCCTGCGACATTCTATAAATATCTCGAGATATTTATAGAATGTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010065.1-1295s1c1
Sequence:CCGGGCCTTTGAAACCATTGTGAAACTCGAGTTTCACAATGGTTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010065.1-1795s1c1
Sequence:CCGGCTTCATGTCAAGCAAGCATATCTCGAGATATGCTTGCTTGACATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010065.1-2275s1c1
Sequence:CCGGGCTCAGTATTATCGGCGACATCTCGAGATGTCGCCGATAATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010065.1-550s1c1
Sequence:CCGGGCTTATGCAGTTCGTCACTAACTCGAGTTAGTGACGAACTGCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004408
VALIDATED
DNM1 MISSION shRNA Bacterial Glycerol Stock
dynamin 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004408.2-1164s21c1
Sequence:GTACCGGAGCCCGCATTAACCGAATCTTCTCGAGAAGATTCGGTTAATGCGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-617s21c1
Sequence:GTACCGGCCAACTCTGACCTGGCCAATTCTCGAGAATTGGCCAGGTCAGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-3043s21c1
Sequence:GTACCGGTCCAGTGAGCCTCCTTGTCATCTCGAGATGACAAGGAGGCTCACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-813s21c1
Sequence:GTACCGGTGATGGCAAGAAGGACATTACCTCGAGGTAATGTCCTTCTTGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-1100s21c1
Sequence:GTACCGGTAGACTTTGAGAAGCGCATTGCTCGAGCAATGCGCTTCTCAAAGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004408.2-993s21c1
Sequence:CCGGCCAGCTACTGTCCATTGAGAACTCGAGTTCTCAATGGACAGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004408.2-1374s21c1
Sequence:CCGGCATGGTTATCTCGGAGCTAATCTCGAGATTAGCTCCGAGATAACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-306s21c1
Sequence:CCGGGGTCAATGCAACCACAGAATACTCGAGTATTCTGTGGTTGCATTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-1509s21c1
Sequence:CCGGGGTCATGCTTCTCATCGATATCTCGAGATATCGATGAGAAGCATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-549s21c1
Sequence:GTACCGGCCAGATCCGAGACATGCTTATCTCGAGATAAGCATGTCTCGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-3017s21c1
Sequence:GTACCGGGACATCCCACTCCAAAGTGTGCTCGAGCACACTTTGGAGTGGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004408.1-1637s1c1
Sequence:CCGGGCTGGCTGACTATCAATAATACTCGAGTATTATTGATAGTCAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004408.1-849s1c1
Sequence:CCGGCCATCCATCTTATCGCCACTTCTCGAGAAGTGGCGATAAGATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004408.1-2052s1c1
Sequence:CCGGCCGGAATCTTGTGGACTCATACTCGAGTATGAGTCCACAAGATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004408.1-535s1c1
Sequence:CCGGCGAGACATGCTTATGCAGTTTCTCGAGAAACTGCATAAGCATGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004408.1-972s1c1
Sequence:CCGGCCAGCTACTGTCCATTGAGAACTCGAGTTCTCAATGGACAGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004408
VALIDATED
DNM1 MISSION shRNA shRNA Plasmid DNA
dynamin 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004408.2-1164s21c1
Sequence:GTACCGGAGCCCGCATTAACCGAATCTTCTCGAGAAGATTCGGTTAATGCGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-617s21c1
Sequence:GTACCGGCCAACTCTGACCTGGCCAATTCTCGAGAATTGGCCAGGTCAGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-3043s21c1
Sequence:GTACCGGTCCAGTGAGCCTCCTTGTCATCTCGAGATGACAAGGAGGCTCACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-813s21c1
Sequence:GTACCGGTGATGGCAAGAAGGACATTACCTCGAGGTAATGTCCTTCTTGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-1100s21c1
Sequence:GTACCGGTAGACTTTGAGAAGCGCATTGCTCGAGCAATGCGCTTCTCAAAGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004408.2-993s21c1
Sequence:CCGGCCAGCTACTGTCCATTGAGAACTCGAGTTCTCAATGGACAGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004408.2-1374s21c1
Sequence:CCGGCATGGTTATCTCGGAGCTAATCTCGAGATTAGCTCCGAGATAACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-306s21c1
Sequence:CCGGGGTCAATGCAACCACAGAATACTCGAGTATTCTGTGGTTGCATTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-1509s21c1
Sequence:CCGGGGTCATGCTTCTCATCGATATCTCGAGATATCGATGAGAAGCATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-549s21c1
Sequence:GTACCGGCCAGATCCGAGACATGCTTATCTCGAGATAAGCATGTCTCGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-3017s21c1
Sequence:GTACCGGGACATCCCACTCCAAAGTGTGCTCGAGCACACTTTGGAGTGGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004408.1-1637s1c1
Sequence:CCGGGCTGGCTGACTATCAATAATACTCGAGTATTATTGATAGTCAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004408.1-849s1c1
Sequence:CCGGCCATCCATCTTATCGCCACTTCTCGAGAAGTGGCGATAAGATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004408.1-2052s1c1
Sequence:CCGGCCGGAATCTTGTGGACTCATACTCGAGTATGAGTCCACAAGATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004408.1-535s1c1
Sequence:CCGGCGAGACATGCTTATGCAGTTTCTCGAGAAACTGCATAAGCATGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004408.1-972s1c1
Sequence:CCGGCCAGCTACTGTCCATTGAGAACTCGAGTTCTCAATGGACAGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004408
VALIDATED
DNM1 MISSION shRNA Lentiviral Transduction Particles
dynamin 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004408.2-1164s21c1
Sequence:GTACCGGAGCCCGCATTAACCGAATCTTCTCGAGAAGATTCGGTTAATGCGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-617s21c1
Sequence:GTACCGGCCAACTCTGACCTGGCCAATTCTCGAGAATTGGCCAGGTCAGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-3043s21c1
Sequence:GTACCGGTCCAGTGAGCCTCCTTGTCATCTCGAGATGACAAGGAGGCTCACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-813s21c1
Sequence:GTACCGGTGATGGCAAGAAGGACATTACCTCGAGGTAATGTCCTTCTTGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-1100s21c1
Sequence:GTACCGGTAGACTTTGAGAAGCGCATTGCTCGAGCAATGCGCTTCTCAAAGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004408.2-993s21c1
Sequence:CCGGCCAGCTACTGTCCATTGAGAACTCGAGTTCTCAATGGACAGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004408.2-1374s21c1
Sequence:CCGGCATGGTTATCTCGGAGCTAATCTCGAGATTAGCTCCGAGATAACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-306s21c1
Sequence:CCGGGGTCAATGCAACCACAGAATACTCGAGTATTCTGTGGTTGCATTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-1509s21c1
Sequence:CCGGGGTCATGCTTCTCATCGATATCTCGAGATATCGATGAGAAGCATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-549s21c1
Sequence:GTACCGGCCAGATCCGAGACATGCTTATCTCGAGATAAGCATGTCTCGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004408.2-3017s21c1
Sequence:GTACCGGGACATCCCACTCCAAAGTGTGCTCGAGCACACTTTGGAGTGGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004408.1-1637s1c1
Sequence:CCGGGCTGGCTGACTATCAATAATACTCGAGTATTATTGATAGTCAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004408.1-849s1c1
Sequence:CCGGCCATCCATCTTATCGCCACTTCTCGAGAAGTGGCGATAAGATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004408.1-2052s1c1
Sequence:CCGGCCGGAATCTTGTGGACTCATACTCGAGTATGAGTCCACAAGATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004408.1-535s1c1
Sequence:CCGGCGAGACATGCTTATGCAGTTTCTCGAGAAACTGCATAAGCATGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004408.1-972s1c1
Sequence:CCGGCCAGCTACTGTCCATTGAGAACTCGAGTTCTCAATGGACAGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks