EMAIL THIS PAGE TO A FRIEND

DNM1L

dynamin 1-like

128 Gene Product Result for
Synonyms: DLP1 DRP1 DVLP DYMPLE EMPF HDYNIV
Gene ID:
Human(10059) Summary: This gene encodes a member of the dynamin superfamily of GTPases. The encoded protein mediates mitochondrial and peroxisomal division, and is involved in developmentally regulated apoptosis and programmed necrosis. Dysfunction of this gene is implicated in several neurological disorders, including Alzheimer's disease. Mutations in this gene are associated with the autosomal dominant disorder, encephalopathy, lethal, due to defective mitochondrial and peroxisomal fission (EMPF). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Mouse(74006) dynamin 1-like
Rat(114114) dynamin 1-like
Zebrafish(393896) dynamin 1-like
domestic cat(101094189) dynamin 1-like
cow(540892) dynamin 1-like
dog(477649) dynamin 1-like
chicken(418132) dynamin 1-like
naked mole-rat(101713152) dynamin 1-like
sheep(101108646) dynamin 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012062 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005690 Rosetta Predictions human pricing
NM_012062 Rosetta Predictions human pricing
NM_012063 Rosetta Predictions human pricing
NM_053655 Rosetta Predictions rat pricing
NM_001025947 Rosetta Predictions mouse pricing
NM_152816 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340086 predicted 2271
2 SASI_Hs02_00340087 predicted 928
3 SASI_Hs02_00340088 predicted 837
4 SASI_Hs01_00231842 predicted 1499
5 SASI_Hs02_00340089 predicted 871
6 SASI_Hs01_00231843 predicted 1234
7 SASI_Hs01_00231845 predicted 1519
8 SASI_Hs01_00231846 predicted 2082
9 SASI_Hs02_00340090 predicted 2301
10 SASI_Hs02_00340091 predicted 977
11 SASI_Hs01_00231844 predicted 453
12 SASI_Hs01_00231847 predicted 1408
13 SASI_Hs01_00231848 predicted 1400
14 SASI_Hs01_00231849 predicted 967
15 SASI_Hs01_00231850 predicted 2030
16 SASI_Hs01_00231851 predicted 1892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343520 predicted 2381
2 SASI_Hs02_00343521 predicted 929
3 SASI_Hs02_00343522 predicted 836
4 SASI_Hs01_00017794 predicted 1498
5 SASI_Hs02_00343523 predicted 869
6 SASI_Hs01_00017795 predicted 1233
7 SASI_Hs01_00017797 predicted 1518
8 SASI_Hs01_00017798 predicted 2194
9 SASI_Hs02_00343524 predicted 2409
10 SASI_Hs02_00343525 predicted 977
11 SASI_Hs01_00017796 predicted 461
12 SASI_Hs01_00017799 predicted 1414
13 SASI_Hs01_00017800 predicted 1395
14 SASI_Hs01_00017801 predicted 966
15 SASI_Hs01_00017802 predicted 2134
16 SASI_Hs01_00017803 predicted 2006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343526 predicted 2303
2 SASI_Hs02_00343527 predicted 932
3 SASI_Hs02_00343528 predicted 839
4 SASI_Hs01_00156941 predicted 1500
5 SASI_Hs02_00343529 predicted 878
6 SASI_Hs01_00156942 predicted 1231
7 SASI_Hs01_00156944 predicted 1521
8 SASI_Hs01_00156945 predicted 2114
9 SASI_Hs02_00343530 predicted 2337
10 SASI_Hs02_00343531 predicted 973
11 SASI_Hs01_00156943 predicted 459
12 SASI_Hs01_00156946 predicted 1417
13 SASI_Hs01_00156947 predicted 1395
14 SASI_Hs01_00156948 predicted 969
15 SASI_Hs01_00156949 predicted 2066
16 SASI_Hs01_00156950 predicted 1930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056764 predicted 1185
2 SASI_Rn01_00056765 predicted 871
3 SASI_Rn01_00056766 predicted 936
4 SASI_Rn01_00056767 predicted 846
5 SASI_Rn01_00056768 predicted 1621
6 SASI_Rn01_00056770 predicted 634
7 SASI_Rn01_00056771 predicted 654
8 SASI_Rn01_00056772 predicted 864
9 SASI_Rn02_00266383 predicted 595
10 SASI_Rn02_00266384 predicted 1500
11 SASI_Rn01_00056763 predicted 1962
12 SASI_Rn01_00056769 predicted 1746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025947 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125369 predicted 1918
2 SASI_Mm01_00125370 predicted 882
3 SASI_Mm01_00125371 predicted 681
4 SASI_Mm02_00288009 predicted 2338
5 SASI_Mm01_00125372 predicted 1619
6 SASI_Mm01_00125373 predicted 1156
7 SASI_Mm01_00125374 predicted 1041
8 SASI_Mm01_00125375 predicted 1796
9 SASI_Mm01_00125376 predicted 871
10 SASI_Mm01_00125377 predicted 1657
11 SASI_Mm01_00125378 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169382 predicted 1957
2 SASI_Mm01_00169383 predicted 913
3 SASI_Mm01_00169384 predicted 719
4 SASI_Mm02_00342826 predicted 2380
5 SASI_Mm01_00169385 predicted 1659
6 SASI_Mm01_00169386 predicted 1189
7 SASI_Mm01_00169387 predicted 1078
8 SASI_Mm01_00169388 predicted 1838
9 SASI_Mm01_00169389 predicted 901
10 SASI_Mm01_00169390 predicted 1698
11 SASI_Mm01_00169391 predicted 703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012062
VALIDATED
DNM1L MISSION shRNA Bacterial Glycerol Stock
dynamin 1-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012062.x-2665s1c1
Sequence:CCGGGCACCAAGACAACATTTCATACTCGAGTATGAAATGTTGTCTTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012062.x-1155s1c1
Sequence:CCGGCGGTGGTGCTAGAATTTGTTACTCGAGTAACAAATTCTAGCACCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012062.x-586s1c1
Sequence:CCGGCGGTTCATCAGTAATCCTAATCTCGAGATTAGGATTACTGATGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012062.x-1063s1c1
Sequence:CCGGGCTACTTTACTCCAACTTATTCTCGAGAATAAGTTGGAGTAAAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012062.x-1996s1c1
Sequence:CCGGCGAGATTGTGAGGTTATTGAACTCGAGTTCAATAACCTCACAATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012062.3-675s21c1
Sequence:CCGGCGGTTCATCAGTAATCCTAATCTCGAGATTAGGATTACTGATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012062.3-2085s21c1
Sequence:CCGGCGAGATTGTGAGGTTATTGAACTCGAGTTCAATAACCTCACAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012062.3-1244s21c1
Sequence:CCGGCGGTGGTGCTAGAATTTGTTACTCGAGTAACAAATTCTAGCACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012062.3-1152s21c1
Sequence:CCGGGCTACTTTACTCCAACTTATTCTCGAGAATAAGTTGGAGTAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012062
VALIDATED
DNM1L MISSION shRNA shRNA Plasmid DNA
dynamin 1-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012062.x-2665s1c1
Sequence:CCGGGCACCAAGACAACATTTCATACTCGAGTATGAAATGTTGTCTTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012062.x-1155s1c1
Sequence:CCGGCGGTGGTGCTAGAATTTGTTACTCGAGTAACAAATTCTAGCACCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012062.x-586s1c1
Sequence:CCGGCGGTTCATCAGTAATCCTAATCTCGAGATTAGGATTACTGATGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012062.x-1063s1c1
Sequence:CCGGGCTACTTTACTCCAACTTATTCTCGAGAATAAGTTGGAGTAAAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012062.x-1996s1c1
Sequence:CCGGCGAGATTGTGAGGTTATTGAACTCGAGTTCAATAACCTCACAATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012062.3-675s21c1
Sequence:CCGGCGGTTCATCAGTAATCCTAATCTCGAGATTAGGATTACTGATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012062.3-2085s21c1
Sequence:CCGGCGAGATTGTGAGGTTATTGAACTCGAGTTCAATAACCTCACAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012062.3-1244s21c1
Sequence:CCGGCGGTGGTGCTAGAATTTGTTACTCGAGTAACAAATTCTAGCACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012062.3-1152s21c1
Sequence:CCGGGCTACTTTACTCCAACTTATTCTCGAGAATAAGTTGGAGTAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012062
VALIDATED
DNM1L MISSION shRNA Lentiviral Transduction Particles
dynamin 1-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012062.x-2665s1c1
Sequence:CCGGGCACCAAGACAACATTTCATACTCGAGTATGAAATGTTGTCTTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012062.x-1155s1c1
Sequence:CCGGCGGTGGTGCTAGAATTTGTTACTCGAGTAACAAATTCTAGCACCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012062.x-586s1c1
Sequence:CCGGCGGTTCATCAGTAATCCTAATCTCGAGATTAGGATTACTGATGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012062.x-1063s1c1
Sequence:CCGGGCTACTTTACTCCAACTTATTCTCGAGAATAAGTTGGAGTAAAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012062.x-1996s1c1
Sequence:CCGGCGAGATTGTGAGGTTATTGAACTCGAGTTCAATAACCTCACAATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012062.3-675s21c1
Sequence:CCGGCGGTTCATCAGTAATCCTAATCTCGAGATTAGGATTACTGATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012062.3-2085s21c1
Sequence:CCGGCGAGATTGTGAGGTTATTGAACTCGAGTTCAATAACCTCACAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012062.3-1244s21c1
Sequence:CCGGCGGTGGTGCTAGAATTTGTTACTCGAGTAACAAATTCTAGCACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012062.3-1152s21c1
Sequence:CCGGGCTACTTTACTCCAACTTATTCTCGAGAATAAGTTGGAGTAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152816
VALIDATED
DNM1L MISSION shRNA Bacterial Glycerol Stock
dynamin 1-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152816.1-955s1c1
Sequence:CCGGGCTCGGTATCAGTCTCTTCTACTCGAGTAGAAGAGACTGATACCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152816.1-1101s1c1
Sequence:CCGGCGGTGGTGCTAGGATTTGTTACTCGAGTAACAAATCCTAGCACCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152816.1-761s1c1
Sequence:CCGGGCCAACTGGATATTAACAATACTCGAGTATTGTTAATATCCAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152816.1-507s1c1
Sequence:CCGGGCTTCAGATCAGAGAACTTATCTCGAGATAAGTTCTCTGATCTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152816.1-1228s1c1
Sequence:CCGGCCTGCTTTATTTGTGCCTGAACTCGAGTTCAGGCACAAATAAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152816.2-947s21c1
Sequence:CCGGGCCAACTGGATATTAACAATACTCGAGTATTGTTAATATCCAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152816.2-1287s21c1
Sequence:CCGGCGGTGGTGCTAGGATTTGTTACTCGAGTAACAAATCCTAGCACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152816.2-1665s21c1
Sequence:CCGGGGCAATTGAGCTAGCGTATATCTCGAGATATACGCTAGCTCAATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152816.2-2651s21c1
Sequence:CCGGCTATAATGCATGCACTATTTACTCGAGTAAATAGTGCATGCATTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152816.2-693s21c1
Sequence:CCGGGCTTCAGATCAGAGAACTTATCTCGAGATAAGTTCTCTGATCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152816
VALIDATED
DNM1L MISSION shRNA shRNA Plasmid DNA
dynamin 1-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152816.1-955s1c1
Sequence:CCGGGCTCGGTATCAGTCTCTTCTACTCGAGTAGAAGAGACTGATACCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152816.1-1101s1c1
Sequence:CCGGCGGTGGTGCTAGGATTTGTTACTCGAGTAACAAATCCTAGCACCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152816.1-761s1c1
Sequence:CCGGGCCAACTGGATATTAACAATACTCGAGTATTGTTAATATCCAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152816.1-507s1c1
Sequence:CCGGGCTTCAGATCAGAGAACTTATCTCGAGATAAGTTCTCTGATCTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152816.1-1228s1c1
Sequence:CCGGCCTGCTTTATTTGTGCCTGAACTCGAGTTCAGGCACAAATAAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152816.2-947s21c1
Sequence:CCGGGCCAACTGGATATTAACAATACTCGAGTATTGTTAATATCCAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152816.2-1287s21c1
Sequence:CCGGCGGTGGTGCTAGGATTTGTTACTCGAGTAACAAATCCTAGCACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152816.2-1665s21c1
Sequence:CCGGGGCAATTGAGCTAGCGTATATCTCGAGATATACGCTAGCTCAATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152816.2-2651s21c1
Sequence:CCGGCTATAATGCATGCACTATTTACTCGAGTAAATAGTGCATGCATTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152816.2-693s21c1
Sequence:CCGGGCTTCAGATCAGAGAACTTATCTCGAGATAAGTTCTCTGATCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152816
VALIDATED
DNM1L MISSION shRNA Lentiviral Transduction Particles
dynamin 1-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152816.1-955s1c1
Sequence:CCGGGCTCGGTATCAGTCTCTTCTACTCGAGTAGAAGAGACTGATACCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152816.1-1101s1c1
Sequence:CCGGCGGTGGTGCTAGGATTTGTTACTCGAGTAACAAATCCTAGCACCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152816.1-761s1c1
Sequence:CCGGGCCAACTGGATATTAACAATACTCGAGTATTGTTAATATCCAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_152816.1-507s1c1
Sequence:CCGGGCTTCAGATCAGAGAACTTATCTCGAGATAAGTTCTCTGATCTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152816.1-1228s1c1
Sequence:CCGGCCTGCTTTATTTGTGCCTGAACTCGAGTTCAGGCACAAATAAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152816.2-947s21c1
Sequence:CCGGGCCAACTGGATATTAACAATACTCGAGTATTGTTAATATCCAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152816.2-1287s21c1
Sequence:CCGGCGGTGGTGCTAGGATTTGTTACTCGAGTAACAAATCCTAGCACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152816.2-1665s21c1
Sequence:CCGGGGCAATTGAGCTAGCGTATATCTCGAGATATACGCTAGCTCAATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_152816.2-2651s21c1
Sequence:CCGGCTATAATGCATGCACTATTTACTCGAGTAAATAGTGCATGCATTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152816.2-693s21c1
Sequence:CCGGGCTTCAGATCAGAGAACTTATCTCGAGATAAGTTCTCTGATCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks