EMAIL THIS PAGE TO A FRIEND

DNM1P46

DNM1 pseudogene 46

20 Gene Product Result for
Synonyms: C15orf51 DNM1DN14.2 DNM1DN14@
Species: Human DNM1P46(196968)
UniProtKB ID: Q6ZS02, Q3ZCN3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194295 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194295 Rosetta Predictions human pricing
NR_003260 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244047 predicted 409
2 SASI_Hs01_00244048 predicted 424
3 SASI_Hs01_00244049 predicted 410
4 SASI_Hs01_00244050 predicted 447
5 SASI_Hs01_00244051 predicted 233
6 SASI_Hs01_00244052 predicted 1260
7 SASI_Hs01_00244053 predicted 191
8 SASI_Hs01_00244054 predicted 186
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378977 predicted 2285
2 SASI_Hs02_00378978 predicted 2257
3 SASI_Hs02_00378979 predicted 406
4 SASI_Hs02_00378980 predicted 414
5 SASI_Hs02_00378981 predicted 405
6 SASI_Hs02_00378982 predicted 227
7 SASI_Hs02_00378983 predicted 2093
8 SASI_Hs02_00378984 predicted 2087
9 SASI_Hs02_00378985 predicted 2254
10 SASI_Hs02_00378986 predicted 505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194295
DNM1P46 MISSION shRNA Bacterial Glycerol Stock
DNM1 pseudogene 46
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194295.1-3397s1c1
Sequence:CCGGGCAGACTATATTATCCAACATCTCGAGATGTTGGATAATATAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194295.1-328s1c1
Sequence:CCGGGCAAATGGAAACCACCCAGAACTCGAGTTCTGGGTGGTTTCCATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194295.1-431s1c1
Sequence:CCGGATCATGATCTACAATGTGCATCTCGAGATGCACATTGTAGATCATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194295.1-228s1c1
Sequence:CCGGGTGTTGAGACAAGAAACGTAACTCGAGTTACGTTTCTTGTCTCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194295.1-219s1c1
Sequence:CCGGGAAATGTTAGTGTTGAGACAACTCGAGTTGTCTCAACACTAACATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194295
DNM1P46 MISSION shRNA shRNA Plasmid DNA
DNM1 pseudogene 46
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194295.1-3397s1c1
Sequence:CCGGGCAGACTATATTATCCAACATCTCGAGATGTTGGATAATATAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194295.1-328s1c1
Sequence:CCGGGCAAATGGAAACCACCCAGAACTCGAGTTCTGGGTGGTTTCCATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194295.1-431s1c1
Sequence:CCGGATCATGATCTACAATGTGCATCTCGAGATGCACATTGTAGATCATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194295.1-228s1c1
Sequence:CCGGGTGTTGAGACAAGAAACGTAACTCGAGTTACGTTTCTTGTCTCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194295.1-219s1c1
Sequence:CCGGGAAATGTTAGTGTTGAGACAACTCGAGTTGTCTCAACACTAACATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194295
DNM1P46 MISSION shRNA Lentiviral Transduction Particles
DNM1 pseudogene 46
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194295.1-3397s1c1
Sequence:CCGGGCAGACTATATTATCCAACATCTCGAGATGTTGGATAATATAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194295.1-328s1c1
Sequence:CCGGGCAAATGGAAACCACCCAGAACTCGAGTTCTGGGTGGTTTCCATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194295.1-431s1c1
Sequence:CCGGATCATGATCTACAATGTGCATCTCGAGATGCACATTGTAGATCATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194295.1-228s1c1
Sequence:CCGGGTGTTGAGACAAGAAACGTAACTCGAGTTACGTTTCTTGTCTCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194295.1-219s1c1
Sequence:CCGGGAAATGTTAGTGTTGAGACAACTCGAGTTGTCTCAACACTAACATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)