EMAIL THIS PAGE TO A FRIEND

DNM2

dynamin 2

Synonyms: CMT2M CMTDI1 CMTDIB DI-CMTB DYN2 DYNII LCCS5
Gene ID:
Human(1785) Summary: Dynamins represent one of the subfamilies of GTP-binding proteins. These proteins share considerable sequence similarity over the N-terminal portion of the molecule, which contains the GTPase domain. Dynamins are associated with microtubules. They have been implicated in cell processes such as endocytosis and cell motility, and in alterations of the membrane that accompany certain activities such as bone resorption by osteoclasts. Dynamins bind many proteins that bind actin and other cytoskeletal proteins. Dynamins can also self-assemble, a process that stimulates GTPase activity. Five alternatively spliced transcripts encoding different proteins have been described. Additional alternatively spliced transcripts may exist, but their full-length nature has not been determined. [provided by RefSeq, Jun 2010]
Mouse(13430) dynamin 2
Rat(25751) dynamin 2
dog(484949) dynamin 2
cow(511691) dynamin 2
sheep(101115027) dynamin 2
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004945 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039520 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039520 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039520 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU209401 MISSION® esiRNA esiRNA targeting mouse Dnm2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005360 Rosetta Predictions human pricing
NM_001005361 Rosetta Predictions human pricing
NM_001005362 Rosetta Predictions human pricing
NM_004945 Rosetta Predictions human pricing
NM_013199 Rosetta Predictions rat pricing
NM_001039520 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227659 predicted 3039
2 SASI_Hs01_00227660 predicted 2339
3 SASI_Hs01_00227661 predicted 686
4 SASI_Hs01_00227662 predicted 610
5 SASI_Hs01_00227664 predicted 547
6 SASI_Hs01_00227665 predicted 3150
7 SASI_Hs01_00227666 predicted 607
8 SASI_Hs01_00227667 predicted 3043
9 SASI_Hs01_00227668 predicted 3128
10 SASI_Hs02_00304867 predicted 2153
11 SASI_Hs01_00227663 predicted 3122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150975 predicted 3048
2 SASI_Hs01_00150976 predicted 2344
3 SASI_Hs01_00150977 predicted 693
4 SASI_Hs01_00150978 predicted 608
5 SASI_Hs01_00150980 predicted 546
6 SASI_Hs01_00150981 predicted 3147
7 SASI_Hs01_00150982 predicted 610
8 SASI_Hs01_00150983 predicted 3040
9 SASI_Hs01_00150984 predicted 3128
10 SASI_Hs02_00304868 predicted 2153
11 SASI_Hs01_00150979 predicted 3119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086490 predicted 3036
2 SASI_Hs01_00086491 predicted 2334
3 SASI_Hs01_00086492 predicted 685
4 SASI_Hs01_00086493 predicted 609
5 SASI_Hs01_00086495 predicted 539
6 SASI_Hs01_00086496 predicted 3131
7 SASI_Hs01_00086497 predicted 609
8 SASI_Hs01_00086498 predicted 3030
9 SASI_Hs01_00086499 predicted 3116
10 SASI_Hs02_00304869 predicted 2140
11 SASI_Hs01_00086494 predicted 3110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053338 predicted 3029
2 SASI_Hs01_00053339 predicted 2325
3 SASI_Hs01_00053340 predicted 685
4 SASI_Hs01_00053341 predicted 612
5 SASI_Hs01_00053343 predicted 539
6 SASI_Hs01_00053344 predicted 3139
7 SASI_Hs01_00053345 predicted 603
8 SASI_Hs01_00053346 predicted 3030
9 SASI_Hs01_00053347 predicted 3118
10 SASI_Hs02_00338616 predicted 2136
11 SASI_Hs01_00053342 predicted 3112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051584 predicted 1430
2 SASI_Rn01_00051585 predicted 1578
3 SASI_Rn01_00051586 predicted 2079
4 SASI_Rn01_00051587 predicted 1366
5 SASI_Rn01_00051589 predicted 798
6 SASI_Rn02_00261071 predicted 2072
7 SASI_Rn01_00051590 predicted 1145
8 SASI_Rn01_00051592 predicted 717
9 SASI_Rn01_00051593 predicted 1268
10 SASI_Rn02_00261072 predicted 821
11 SASI_Rn01_00051588 predicted 638
12 SASI_Rn01_00051591 predicted 2560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052642 predicted 773
2 SASI_Mm02_00290115 predicted 1225
3 SASI_Mm01_00052643 predicted 1787
4 SASI_Mm01_00052644 predicted 838
5 SASI_Mm01_00052645 predicted 1730
6 SASI_Mm01_00052646 predicted 833
7 SASI_Mm01_00052647 predicted 1373
8 SASI_Mm01_00052648 predicted 535
9 SASI_Mm01_00052649 predicted 2403
10 SASI_Mm01_00052651 predicted 596
11 SASI_Mm01_00052650 predicted 352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004945
VALIDATED
DNM2 MISSION shRNA Bacterial Glycerol Stock
dynamin 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004945.1-3242s1c1
Sequence:CCGGCCTGAGGTGTACATAGTCCTTCTCGAGAAGGACTATGTACACCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004945.1-1834s1c1
Sequence:CCGGGACAACCTCAAGATCCGTGATCTCGAGATCACGGATCTTGAGGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004945.1-1590s1c1
Sequence:CCGGGCAGTCCTACATCAACACGAACTCGAGTTCGTGTTGATGTAGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004945.1-1515s1c1
Sequence:CCGGGCGAATCGTCACCACTTACATCTCGAGATGTAAGTGGTGACGATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004945.1-819s1c1
Sequence:CCGGCCCGTTGAGAAGAGGCTACATCTCGAGATGTAGCCTCTTCTCAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-190s21c1
Sequence:GTACCGGTGATCCCGCTGGTCAACAAACCTCGAGGTTTGTTGACCAGCGGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-991s21c1
Sequence:CCGGATCTGCAGAAGACGCTGAATCCTCGAGGATTCAGCGTCTTCTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-1610s21c1
Sequence:CCGGGCAGTCCTACATCAACACGAACTCGAGTTCGTGTTGATGTAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-839s21c1
Sequence:CCGGCCCGTTGAGAAGAGGCTACATCTCGAGATGTAGCCTCTTCTCAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-1479s21c1
Sequence:CCGGGTTAGGCAGTGTACCAGTAAGCTCGAGCTTACTGGTACACTGCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-3112s21c1
Sequence:CCGGATGTAGGGCAGGCCTTCTATACTCGAGTATAGAAGGCCTGCCCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-1533s21c1
Sequence:GTACCGGGAGCGAATCGTCACCACTTACCTCGAGGTAAGTGGTGACGATTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-1588s21c1
Sequence:GTACCGGTTCTTCTGCTGATCGACATTGCTCGAGCAATGTCGATCAGCAGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-1260s21c1
Sequence:GTACCGGTTCCACGAGCGGTTCCCATTTCTCGAGAAATGGGAACCGCTCGTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004945
VALIDATED
DNM2 MISSION shRNA shRNA Plasmid DNA
dynamin 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004945.1-3242s1c1
Sequence:CCGGCCTGAGGTGTACATAGTCCTTCTCGAGAAGGACTATGTACACCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004945.1-1834s1c1
Sequence:CCGGGACAACCTCAAGATCCGTGATCTCGAGATCACGGATCTTGAGGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004945.1-1590s1c1
Sequence:CCGGGCAGTCCTACATCAACACGAACTCGAGTTCGTGTTGATGTAGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004945.1-1515s1c1
Sequence:CCGGGCGAATCGTCACCACTTACATCTCGAGATGTAAGTGGTGACGATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004945.1-819s1c1
Sequence:CCGGCCCGTTGAGAAGAGGCTACATCTCGAGATGTAGCCTCTTCTCAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-190s21c1
Sequence:GTACCGGTGATCCCGCTGGTCAACAAACCTCGAGGTTTGTTGACCAGCGGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-991s21c1
Sequence:CCGGATCTGCAGAAGACGCTGAATCCTCGAGGATTCAGCGTCTTCTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-1610s21c1
Sequence:CCGGGCAGTCCTACATCAACACGAACTCGAGTTCGTGTTGATGTAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-839s21c1
Sequence:CCGGCCCGTTGAGAAGAGGCTACATCTCGAGATGTAGCCTCTTCTCAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-1479s21c1
Sequence:CCGGGTTAGGCAGTGTACCAGTAAGCTCGAGCTTACTGGTACACTGCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-3112s21c1
Sequence:CCGGATGTAGGGCAGGCCTTCTATACTCGAGTATAGAAGGCCTGCCCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-1533s21c1
Sequence:GTACCGGGAGCGAATCGTCACCACTTACCTCGAGGTAAGTGGTGACGATTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-1588s21c1
Sequence:GTACCGGTTCTTCTGCTGATCGACATTGCTCGAGCAATGTCGATCAGCAGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-1260s21c1
Sequence:GTACCGGTTCCACGAGCGGTTCCCATTTCTCGAGAAATGGGAACCGCTCGTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004945
VALIDATED
DNM2 MISSION shRNA Lentiviral Transduction Particles
dynamin 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004945.1-3242s1c1
Sequence:CCGGCCTGAGGTGTACATAGTCCTTCTCGAGAAGGACTATGTACACCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004945.1-1834s1c1
Sequence:CCGGGACAACCTCAAGATCCGTGATCTCGAGATCACGGATCTTGAGGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004945.1-1590s1c1
Sequence:CCGGGCAGTCCTACATCAACACGAACTCGAGTTCGTGTTGATGTAGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004945.1-1515s1c1
Sequence:CCGGGCGAATCGTCACCACTTACATCTCGAGATGTAAGTGGTGACGATTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004945.1-819s1c1
Sequence:CCGGCCCGTTGAGAAGAGGCTACATCTCGAGATGTAGCCTCTTCTCAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-190s21c1
Sequence:GTACCGGTGATCCCGCTGGTCAACAAACCTCGAGGTTTGTTGACCAGCGGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-991s21c1
Sequence:CCGGATCTGCAGAAGACGCTGAATCCTCGAGGATTCAGCGTCTTCTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-1610s21c1
Sequence:CCGGGCAGTCCTACATCAACACGAACTCGAGTTCGTGTTGATGTAGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-839s21c1
Sequence:CCGGCCCGTTGAGAAGAGGCTACATCTCGAGATGTAGCCTCTTCTCAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-1479s21c1
Sequence:CCGGGTTAGGCAGTGTACCAGTAAGCTCGAGCTTACTGGTACACTGCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-3112s21c1
Sequence:CCGGATGTAGGGCAGGCCTTCTATACTCGAGTATAGAAGGCCTGCCCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-1533s21c1
Sequence:GTACCGGGAGCGAATCGTCACCACTTACCTCGAGGTAAGTGGTGACGATTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-1588s21c1
Sequence:GTACCGGTTCTTCTGCTGATCGACATTGCTCGAGCAATGTCGATCAGCAGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004945.2-1260s21c1
Sequence:GTACCGGTTCCACGAGCGGTTCCCATTTCTCGAGAAATGGGAACCGCTCGTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007871
VALIDATED
DNM2 MISSION shRNA Bacterial Glycerol Stock
dynamin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007871.1-2865s1c1
Sequence:CCGGCCTAGTGGACATGACAATGAACTCGAGTTCATTGTCATGTCCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007871.1-1206s1c1
Sequence:CCGGGCCCGCATCAATCGTATCTTTCTCGAGAAAGATACGATTGATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007871.1-803s1c1
Sequence:CCGGGCCCTTGAGAAGAGGCTATATCTCGAGATATAGCCTCTTCTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007871.1-1574s1c1
Sequence:CCGGGCAGTCGTACATCAACACAAACTCGAGTTTGTGTTGATGTACGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007871.1-1209s1c1
Sequence:CCGGCGCATCAATCGTATCTTTCATCTCGAGATGAAAGATACGATTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007871
VALIDATED
DNM2 MISSION shRNA shRNA Plasmid DNA
dynamin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007871.1-2865s1c1
Sequence:CCGGCCTAGTGGACATGACAATGAACTCGAGTTCATTGTCATGTCCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007871.1-1206s1c1
Sequence:CCGGGCCCGCATCAATCGTATCTTTCTCGAGAAAGATACGATTGATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007871.1-803s1c1
Sequence:CCGGGCCCTTGAGAAGAGGCTATATCTCGAGATATAGCCTCTTCTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007871.1-1574s1c1
Sequence:CCGGGCAGTCGTACATCAACACAAACTCGAGTTTGTGTTGATGTACGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007871.1-1209s1c1
Sequence:CCGGCGCATCAATCGTATCTTTCATCTCGAGATGAAAGATACGATTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007871
VALIDATED
DNM2 MISSION shRNA Lentiviral Transduction Particles
dynamin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007871.1-2865s1c1
Sequence:CCGGCCTAGTGGACATGACAATGAACTCGAGTTCATTGTCATGTCCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007871.1-1206s1c1
Sequence:CCGGGCCCGCATCAATCGTATCTTTCTCGAGAAAGATACGATTGATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007871.1-803s1c1
Sequence:CCGGGCCCTTGAGAAGAGGCTATATCTCGAGATATAGCCTCTTCTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007871.1-1574s1c1
Sequence:CCGGGCAGTCGTACATCAACACAAACTCGAGTTTGTGTTGATGTACGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007871.1-1209s1c1
Sequence:CCGGCGCATCAATCGTATCTTTCATCTCGAGATGAAAGATACGATTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039520
VALIDATED
DNM2 MISSION shRNA Bacterial Glycerol Stock
dynamin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001039520.1-1229s21c1
Sequence:CCGGGCCCGCATCAATCGTATCTTTCTCGAGAAAGATACGATTGATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001039520.1-826s21c1
Sequence:CCGGGCCCTTGAGAAGAGGCTATATCTCGAGATATAGCCTCTTCTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039520.1-1450s21c1
Sequence:CCGGGGAGCTAGCCACGGTCATTAACTCGAGTTAATGACCGTGGCTAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039520.1-1597s21c1
Sequence:CCGGGCAGTCGTACATCAACACAAACTCGAGTTTGTGTTGATGTACGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001039520.1-3184s21c1
Sequence:CCGGGAGCTCCTTTGGCCATATTAACTCGAGTTAATATGGCCAAAGGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039520
VALIDATED
DNM2 MISSION shRNA shRNA Plasmid DNA
dynamin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001039520.1-1229s21c1
Sequence:CCGGGCCCGCATCAATCGTATCTTTCTCGAGAAAGATACGATTGATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001039520.1-826s21c1
Sequence:CCGGGCCCTTGAGAAGAGGCTATATCTCGAGATATAGCCTCTTCTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039520.1-1450s21c1
Sequence:CCGGGGAGCTAGCCACGGTCATTAACTCGAGTTAATGACCGTGGCTAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039520.1-1597s21c1
Sequence:CCGGGCAGTCGTACATCAACACAAACTCGAGTTTGTGTTGATGTACGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001039520.1-3184s21c1
Sequence:CCGGGAGCTCCTTTGGCCATATTAACTCGAGTTAATATGGCCAAAGGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039520
VALIDATED
DNM2 MISSION shRNA Lentiviral Transduction Particles
dynamin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001039520.1-1229s21c1
Sequence:CCGGGCCCGCATCAATCGTATCTTTCTCGAGAAAGATACGATTGATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001039520.1-826s21c1
Sequence:CCGGGCCCTTGAGAAGAGGCTATATCTCGAGATATAGCCTCTTCTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039520.1-1450s21c1
Sequence:CCGGGGAGCTAGCCACGGTCATTAACTCGAGTTAATGACCGTGGCTAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039520.1-1597s21c1
Sequence:CCGGGCAGTCGTACATCAACACAAACTCGAGTTTGTGTTGATGTACGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001039520.1-3184s21c1
Sequence:CCGGGAGCTCCTTTGGCCATATTAACTCGAGTTAATATGGCCAAAGGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks