EMAIL THIS PAGE TO A FRIEND

DNM3

dynamin 3

268 Gene Product Result for
Synonyms: Dyna III
Gene ID:
Human(26052) Summary: This gene encodes a member of a family of guanosine triphosphate (GTP)-binding proteins that associate with microtubules and are involved in vesicular transport. The encoded protein functions in the development of megakaryocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(103967) dynamin 3
Rat(171574) dynamin 3
Zebrafish(557996) dynamin 3
chicken(424389) dynamin 3
dog(490341) dynamin 3
Horse(100060156) dynamin 3
cow(506315) dynamin 3
sheep(101107117) dynamin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172646 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172646 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172646 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015569 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015569 Rosetta Predictions human pricing
NM_138538 Rosetta Predictions rat pricing
NM_001038619 Rosetta Predictions mouse pricing
NM_172646 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015189 predicted 506
2 SASI_Hs01_00015190 predicted 2194
3 SASI_Hs01_00015192 predicted 564
4 SASI_Hs01_00015194 predicted 1570
5 SASI_Hs01_00015195 predicted 2739
6 SASI_Hs01_00015196 predicted 1763
7 SASI_Hs01_00015197 predicted 1392
8 SASI_Hs02_00348139 predicted 1215
9 SASI_Hs02_00348140 predicted 635
10 SASI_Hs02_00348141 predicted 2315
11 SASI_Hs01_00015191 predicted 1383
12 SASI_Hs01_00015193 predicted 692
13 SASI_Hs01_00015198 predicted 1698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089149 predicted 511
2 SASI_Rn01_00089150 predicted 2829
3 SASI_Rn01_00089151 predicted 992
4 SASI_Rn02_00268175 predicted 1782
5 SASI_Rn01_00089152 predicted 2452
6 SASI_Rn02_00268176 predicted 1288
7 SASI_Rn01_00089153 predicted 2011
8 SASI_Rn01_00089154 predicted 2213
9 SASI_Rn01_00089155 predicted 2103
10 SASI_Rn01_00089156 predicted 2761
11 SASI_Rn01_00089147 predicted 2757
12 SASI_Rn01_00089148 predicted 2187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100588 predicted 2886
2 SASI_Mm02_00289634 predicted 443
3 SASI_Mm01_00100589 predicted 585
4 SASI_Mm02_00289635 predicted 2398
5 SASI_Mm01_00100590 predicted 1075
6 SASI_Mm01_00100592 predicted 1737
7 SASI_Mm01_00100593 predicted 2825
8 SASI_Mm01_00100595 predicted 2769
9 SASI_Mm01_00100596 predicted 2782
10 SASI_Mm01_00100597 predicted 1527
11 SASI_Mm01_00100591 predicted 1062
12 SASI_Mm01_00100594 predicted 2252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344351 predicted 2876
2 SASI_Mm02_00344352 predicted 446
3 SASI_Mm02_00344353 predicted 595
4 SASI_Mm02_00344354 predicted 2396
5 SASI_Mm02_00344355 predicted 1070
6 SASI_Mm02_00344356 predicted 1741
7 SASI_Mm02_00344357 predicted 2811
8 SASI_Mm02_00344358 predicted 2761
9 SASI_Mm02_00344359 predicted 2773
10 SASI_Mm02_00344360 predicted 1530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172646
DNM3 MISSION shRNA Bacterial Glycerol Stock
dynamin 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172646.2-2508s21c1
Sequence:GTACCGGCCCAACGAAGGCTGACGATAACTCGAGTTATCGTCAGCCTTCGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172646.2-654s21c1
Sequence:GTACCGGAGCCGCCAGATATCGAGTATCCTCGAGGATACTCGATATCTGGCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172646.2-1432s21c1
Sequence:GTACCGGGGCGTTTGAGGCAATAGTTAACTCGAGTTAACTATTGCCTCAAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172646.1-596s1c1
Sequence:CCGGCGTGTTAAATCTAACGCTAATCTCGAGATTAGCGTTAGATTTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172646.1-3677s1c1
Sequence:CCGGCCGTTTAGTTATTGTGACTATCTCGAGATAGTCACAATAACTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172646.1-2751s1c1
Sequence:CCGGCCCACTATAATCCGTCCACTACTCGAGTAGTGGACGGATTATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172646.1-554s1c1
Sequence:CCGGCATCTCTTCTATACCCATTAACTCGAGTTAATGGGTATAGAAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172646.1-2079s1c1
Sequence:CCGGCCAGATAAATCTGTAACTGAACTCGAGTTCAGTTACAGATTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172646
DNM3 MISSION shRNA shRNA Plasmid DNA
dynamin 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172646.2-2508s21c1
Sequence:GTACCGGCCCAACGAAGGCTGACGATAACTCGAGTTATCGTCAGCCTTCGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172646.2-654s21c1
Sequence:GTACCGGAGCCGCCAGATATCGAGTATCCTCGAGGATACTCGATATCTGGCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172646.2-1432s21c1
Sequence:GTACCGGGGCGTTTGAGGCAATAGTTAACTCGAGTTAACTATTGCCTCAAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172646.1-596s1c1
Sequence:CCGGCGTGTTAAATCTAACGCTAATCTCGAGATTAGCGTTAGATTTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172646.1-3677s1c1
Sequence:CCGGCCGTTTAGTTATTGTGACTATCTCGAGATAGTCACAATAACTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172646.1-2751s1c1
Sequence:CCGGCCCACTATAATCCGTCCACTACTCGAGTAGTGGACGGATTATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172646.1-554s1c1
Sequence:CCGGCATCTCTTCTATACCCATTAACTCGAGTTAATGGGTATAGAAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172646.1-2079s1c1
Sequence:CCGGCCAGATAAATCTGTAACTGAACTCGAGTTCAGTTACAGATTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172646
DNM3 MISSION shRNA Lentiviral Transduction Particles
dynamin 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172646.2-2508s21c1
Sequence:GTACCGGCCCAACGAAGGCTGACGATAACTCGAGTTATCGTCAGCCTTCGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172646.2-654s21c1
Sequence:GTACCGGAGCCGCCAGATATCGAGTATCCTCGAGGATACTCGATATCTGGCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172646.2-1432s21c1
Sequence:GTACCGGGGCGTTTGAGGCAATAGTTAACTCGAGTTAACTATTGCCTCAAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172646.1-596s1c1
Sequence:CCGGCGTGTTAAATCTAACGCTAATCTCGAGATTAGCGTTAGATTTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172646.1-3677s1c1
Sequence:CCGGCCGTTTAGTTATTGTGACTATCTCGAGATAGTCACAATAACTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172646.1-2751s1c1
Sequence:CCGGCCCACTATAATCCGTCCACTACTCGAGTAGTGGACGGATTATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172646.1-554s1c1
Sequence:CCGGCATCTCTTCTATACCCATTAACTCGAGTTAATGGGTATAGAAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172646.1-2079s1c1
Sequence:CCGGCCAGATAAATCTGTAACTGAACTCGAGTTCAGTTACAGATTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015569
DNM3 MISSION shRNA Bacterial Glycerol Stock
dynamin 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015569.3-2774s21c1
Sequence:GTACCGGGTGTCTGGCATGGCAATTAATCTCGAGATTAATTGCCATGCCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015569.3-561s21c1
Sequence:GTACCGGGTGTTAAATCTAACCCTTATTCTCGAGAATAAGGGTTAGATTTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015569.3-2180s21c1
Sequence:GTACCGGCAAATGTATCCGAGATCTAATCTCGAGATTAGATCTCGGATACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015569.3-3096s21c1
Sequence:GTACCGGGGTAGCTCATTAAACGTAATTCTCGAGAATTACGTTTAATGAGCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015569.2-2329s1c1
Sequence:CCGGCGAATGTATCAAGCACTGAAACTCGAGTTTCAGTGCTTGATACATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015569.2-1906s1c1
Sequence:CCGGGCACTCTTTAATACAGAGCAACTCGAGTTGCTCTGTATTAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015569.2-2710s1c1
Sequence:CCGGCCCACTATAATCCGCCCACTACTCGAGTAGTGGGCGGATTATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015569.2-653s1c1
Sequence:CCGGCGAGGGAGAACTGTCTGATTTCTCGAGAAATCAGACAGTTCTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015569
DNM3 MISSION shRNA shRNA Plasmid DNA
dynamin 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015569.3-2774s21c1
Sequence:GTACCGGGTGTCTGGCATGGCAATTAATCTCGAGATTAATTGCCATGCCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015569.3-561s21c1
Sequence:GTACCGGGTGTTAAATCTAACCCTTATTCTCGAGAATAAGGGTTAGATTTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015569.3-2180s21c1
Sequence:GTACCGGCAAATGTATCCGAGATCTAATCTCGAGATTAGATCTCGGATACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015569.3-3096s21c1
Sequence:GTACCGGGGTAGCTCATTAAACGTAATTCTCGAGAATTACGTTTAATGAGCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015569.2-2329s1c1
Sequence:CCGGCGAATGTATCAAGCACTGAAACTCGAGTTTCAGTGCTTGATACATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015569.2-1906s1c1
Sequence:CCGGGCACTCTTTAATACAGAGCAACTCGAGTTGCTCTGTATTAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015569.2-2710s1c1
Sequence:CCGGCCCACTATAATCCGCCCACTACTCGAGTAGTGGGCGGATTATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015569.2-653s1c1
Sequence:CCGGCGAGGGAGAACTGTCTGATTTCTCGAGAAATCAGACAGTTCTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015569
DNM3 MISSION shRNA Lentiviral Transduction Particles
dynamin 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015569.3-2774s21c1
Sequence:GTACCGGGTGTCTGGCATGGCAATTAATCTCGAGATTAATTGCCATGCCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015569.3-561s21c1
Sequence:GTACCGGGTGTTAAATCTAACCCTTATTCTCGAGAATAAGGGTTAGATTTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015569.3-2180s21c1
Sequence:GTACCGGCAAATGTATCCGAGATCTAATCTCGAGATTAGATCTCGGATACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015569.3-3096s21c1
Sequence:GTACCGGGGTAGCTCATTAAACGTAATTCTCGAGAATTACGTTTAATGAGCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015569.2-2329s1c1
Sequence:CCGGCGAATGTATCAAGCACTGAAACTCGAGTTTCAGTGCTTGATACATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015569.2-1906s1c1
Sequence:CCGGGCACTCTTTAATACAGAGCAACTCGAGTTGCTCTGTATTAAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015569.2-2710s1c1
Sequence:CCGGCCCACTATAATCCGCCCACTACTCGAGTAGTGGGCGGATTATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015569.2-653s1c1
Sequence:CCGGCGAGGGAGAACTGTCTGATTTCTCGAGAAATCAGACAGTTCTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks