EMAIL THIS PAGE TO A FRIEND

DNMBP

dynamin binding protein

58 Gene Product Result for
Synonyms: ARHGEF36 TUBA
UniProtKB ID: Q6XZF7, Q8IVY3, Q9Y2L3
Gene ID:
Human(23268) Summary: DNMBP belongs to the DBL (MIM 311030) family of guanine nucleotide exchange factors and plays a role in the regulation of cell junctions (Otani et al., 2006 [PubMed 17015620]
Mouse(71972) dynamin binding protein
Rat(309362) dynamin binding protein
sheep(101120033) dynamin binding protein
Domestic Rabbit(100343498) dynamin binding protein
domestic guinea pig(100725352) dynamin binding protein
naked mole-rat(101716774) dynamin binding protein
Zebrafish(100005174) dynamin binding protein
dog(477794) dynamin binding protein
cow(782347) dynamin binding protein
Horse(100060622) dynamin binding protein
domestic cat(101086180) dynamin binding protein
chicken(423827) dynamin binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015221 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028029 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028029 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028029 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015221 Rosetta Predictions human pricing
XM_001060754 Rosetta Predictions rat pricing
XM_219860 Rosetta Predictions rat pricing
NM_028029 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074093 predicted 1746
2 SASI_Hs01_00074094 predicted 4529
3 SASI_Hs01_00074095 predicted 1051
4 SASI_Hs02_00347329 predicted 4775
5 SASI_Hs01_00074096 predicted 2776
6 SASI_Hs01_00074097 predicted 1555
7 SASI_Hs01_00074098 predicted 500
8 SASI_Hs01_00074099 predicted 2158
9 SASI_Hs01_00074100 predicted 1652
10 SASI_Hs01_00074101 predicted 1841
11 SASI_Hs01_00074102 predicted 3103
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060754 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297611 predicted 2958
2 SASI_Rn02_00297612 predicted 3795
3 SASI_Rn02_00297613 predicted 763
4 SASI_Rn02_00297614 predicted 2745
5 SASI_Rn02_00297615 predicted 3312
6 SASI_Rn02_00297616 predicted 1778
7 SASI_Rn02_00297617 predicted 422
8 SASI_Rn02_00297618 predicted 1262
9 SASI_Rn02_00297619 predicted 235
10 SASI_Rn02_00297620 predicted 3211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378779 predicted 2958
2 SASI_Rn02_00378780 predicted 3796
3 SASI_Rn02_00378781 predicted 763
4 SASI_Rn02_00378782 predicted 2750
5 SASI_Rn02_00378783 predicted 3314
6 SASI_Rn02_00378784 predicted 1776
7 SASI_Rn02_00378785 predicted 427
8 SASI_Rn02_00378786 predicted 1262
9 SASI_Rn02_00378787 predicted 238
10 SASI_Rn02_00378788 predicted 3214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170476 predicted 1308
2 SASI_Mm01_00170477 predicted 556
3 SASI_Mm01_00170478 predicted 2734
4 SASI_Mm01_00170479 predicted 2858
5 SASI_Mm01_00170480 predicted 3337
6 SASI_Mm01_00170481 predicted 2781
7 SASI_Mm01_00170482 predicted 4611
8 SASI_Mm01_00170484 predicted 2499
9 SASI_Mm01_00170485 predicted 3820
10 SASI_Mm02_00333172 predicted 3173
11 SASI_Mm01_00170483 predicted 2518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015221
VALIDATED
DNMBP MISSION shRNA Bacterial Glycerol Stock
dynamin binding protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015221.1-1210s1c1
Sequence:CCGGGACCCTACAGAAGTAGTCAATCTCGAGATTGACTACTTCTGTAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_015221.1-2197s1c1
Sequence:CCGGGAGGATCTCAAGTTCTGTGAACTCGAGTTCACAGAACTTGAGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015221.1-2634s1c1
Sequence:CCGGGCTGCTTGAAATCTACGAGAACTCGAGTTCTCGTAGATTTCAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015221.1-4258s1c1
Sequence:CCGGGCATCCCTAAATCCGAGTAATCTCGAGATTACTCGGATTTAGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015221.1-1495s1c1
Sequence:CCGGCTCCACAACCTAGCAAGTTATCTCGAGATAACTTGCTAGGTTGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015221.1-3090s1c1
Sequence:CCGGCCGAATGCAAGAAAGATTGATCTCGAGATCAATCTTTCTTGCATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015221.2-157s21c1
Sequence:CCGGCGCTCTTTGTGGGAGATATTACTCGAGTAATATCTCCCACAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015221.2-4352s21c1
Sequence:CCGGATCCCTAAATCCGAGTAATTCCTCGAGGAATTACTCGGATTTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015221.2-5487s21c1
Sequence:CCGGTAGAAGTGTTTAGGGTCTTTACTCGAGTAAAGACCCTAAACACTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015221.2-4784s21c1
Sequence:CCGGCTACGTTCCCTCCAATTATATCTCGAGATATAATTGGAGGGAACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015221.2-508s21c1
Sequence:CCGGTGTTTCAGATTCCGGAATATTCTCGAGAATATTCCGGAATCTGAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015221
VALIDATED
DNMBP MISSION shRNA shRNA Plasmid DNA
dynamin binding protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015221.1-1210s1c1
Sequence:CCGGGACCCTACAGAAGTAGTCAATCTCGAGATTGACTACTTCTGTAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_015221.1-2197s1c1
Sequence:CCGGGAGGATCTCAAGTTCTGTGAACTCGAGTTCACAGAACTTGAGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015221.1-2634s1c1
Sequence:CCGGGCTGCTTGAAATCTACGAGAACTCGAGTTCTCGTAGATTTCAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015221.1-4258s1c1
Sequence:CCGGGCATCCCTAAATCCGAGTAATCTCGAGATTACTCGGATTTAGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015221.1-1495s1c1
Sequence:CCGGCTCCACAACCTAGCAAGTTATCTCGAGATAACTTGCTAGGTTGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015221.1-3090s1c1
Sequence:CCGGCCGAATGCAAGAAAGATTGATCTCGAGATCAATCTTTCTTGCATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015221.2-157s21c1
Sequence:CCGGCGCTCTTTGTGGGAGATATTACTCGAGTAATATCTCCCACAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015221.2-4352s21c1
Sequence:CCGGATCCCTAAATCCGAGTAATTCCTCGAGGAATTACTCGGATTTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015221.2-5487s21c1
Sequence:CCGGTAGAAGTGTTTAGGGTCTTTACTCGAGTAAAGACCCTAAACACTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015221.2-4784s21c1
Sequence:CCGGCTACGTTCCCTCCAATTATATCTCGAGATATAATTGGAGGGAACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015221.2-508s21c1
Sequence:CCGGTGTTTCAGATTCCGGAATATTCTCGAGAATATTCCGGAATCTGAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015221
VALIDATED
DNMBP MISSION shRNA Lentiviral Transduction Particles
dynamin binding protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015221.1-1210s1c1
Sequence:CCGGGACCCTACAGAAGTAGTCAATCTCGAGATTGACTACTTCTGTAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_015221.1-2197s1c1
Sequence:CCGGGAGGATCTCAAGTTCTGTGAACTCGAGTTCACAGAACTTGAGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015221.1-2634s1c1
Sequence:CCGGGCTGCTTGAAATCTACGAGAACTCGAGTTCTCGTAGATTTCAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015221.1-4258s1c1
Sequence:CCGGGCATCCCTAAATCCGAGTAATCTCGAGATTACTCGGATTTAGGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015221.1-1495s1c1
Sequence:CCGGCTCCACAACCTAGCAAGTTATCTCGAGATAACTTGCTAGGTTGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015221.1-3090s1c1
Sequence:CCGGCCGAATGCAAGAAAGATTGATCTCGAGATCAATCTTTCTTGCATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015221.2-157s21c1
Sequence:CCGGCGCTCTTTGTGGGAGATATTACTCGAGTAATATCTCCCACAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015221.2-4352s21c1
Sequence:CCGGATCCCTAAATCCGAGTAATTCCTCGAGGAATTACTCGGATTTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015221.2-5487s21c1
Sequence:CCGGTAGAAGTGTTTAGGGTCTTTACTCGAGTAAAGACCCTAAACACTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015221.2-4784s21c1
Sequence:CCGGCTACGTTCCCTCCAATTATATCTCGAGATATAATTGGAGGGAACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015221.2-508s21c1
Sequence:CCGGTGTTTCAGATTCCGGAATATTCTCGAGAATATTCCGGAATCTGAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028029
VALIDATED
DNMBP MISSION shRNA Bacterial Glycerol Stock
dynamin binding protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028029.1-2857s1c1
Sequence:CCGGCACCCGGATAAAGTGCCTTTACTCGAGTAAAGGCACTTTATCCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028029.1-2793s1c1
Sequence:CCGGCGTACAGAGAATAATGCGTTACTCGAGTAACGCATTATTCTCTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028029.1-904s1c1
Sequence:CCGGCGCTTTGTGAAGTTATGTCCTCTCGAGAGGACATAACTTCACAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028029.1-4718s1c1
Sequence:CCGGGCTACGTCCCATCCAACTATACTCGAGTATAGTTGGATGGGACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028029.2-2743s21c1
Sequence:CCGGCTCAAGGGATGCACCAATTACCTCGAGGTAATTGGTGCATCCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028029.2-1402s21c1
Sequence:CCGGTACGCCCAAGGTTGGTCATTCCTCGAGGAATGACCAACCTTGGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028029.2-4479s21c1
Sequence:CCGGCCAAGGCAGTGACTCTATAAACTCGAGTTTATAGAGTCACTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028029.2-4719s21c1
Sequence:CCGGCTACGTCCCATCCAACTATATCTCGAGATATAGTTGGATGGGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028029.2-2891s21c1
Sequence:CCGGTCGCCGTCAAGGAGATCAATGCTCGAGCATTGATCTCCTTGACGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028029
VALIDATED
DNMBP MISSION shRNA shRNA Plasmid DNA
dynamin binding protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028029.1-2857s1c1
Sequence:CCGGCACCCGGATAAAGTGCCTTTACTCGAGTAAAGGCACTTTATCCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028029.1-2793s1c1
Sequence:CCGGCGTACAGAGAATAATGCGTTACTCGAGTAACGCATTATTCTCTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028029.1-904s1c1
Sequence:CCGGCGCTTTGTGAAGTTATGTCCTCTCGAGAGGACATAACTTCACAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028029.1-4718s1c1
Sequence:CCGGGCTACGTCCCATCCAACTATACTCGAGTATAGTTGGATGGGACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028029.2-2743s21c1
Sequence:CCGGCTCAAGGGATGCACCAATTACCTCGAGGTAATTGGTGCATCCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028029.2-1402s21c1
Sequence:CCGGTACGCCCAAGGTTGGTCATTCCTCGAGGAATGACCAACCTTGGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028029.2-4479s21c1
Sequence:CCGGCCAAGGCAGTGACTCTATAAACTCGAGTTTATAGAGTCACTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028029.2-4719s21c1
Sequence:CCGGCTACGTCCCATCCAACTATATCTCGAGATATAGTTGGATGGGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028029.2-2891s21c1
Sequence:CCGGTCGCCGTCAAGGAGATCAATGCTCGAGCATTGATCTCCTTGACGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028029
VALIDATED
DNMBP MISSION shRNA Lentiviral Transduction Particles
dynamin binding protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028029.1-2857s1c1
Sequence:CCGGCACCCGGATAAAGTGCCTTTACTCGAGTAAAGGCACTTTATCCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028029.1-2793s1c1
Sequence:CCGGCGTACAGAGAATAATGCGTTACTCGAGTAACGCATTATTCTCTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028029.1-904s1c1
Sequence:CCGGCGCTTTGTGAAGTTATGTCCTCTCGAGAGGACATAACTTCACAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028029.1-4718s1c1
Sequence:CCGGGCTACGTCCCATCCAACTATACTCGAGTATAGTTGGATGGGACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028029.2-2743s21c1
Sequence:CCGGCTCAAGGGATGCACCAATTACCTCGAGGTAATTGGTGCATCCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028029.2-1402s21c1
Sequence:CCGGTACGCCCAAGGTTGGTCATTCCTCGAGGAATGACCAACCTTGGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028029.2-4479s21c1
Sequence:CCGGCCAAGGCAGTGACTCTATAAACTCGAGTTTATAGAGTCACTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028029.2-4719s21c1
Sequence:CCGGCTACGTCCCATCCAACTATATCTCGAGATATAGTTGGATGGGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028029.2-2891s21c1
Sequence:CCGGTCGCCGTCAAGGAGATCAATGCTCGAGCATTGATCTCCTTGACGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks