EMAIL THIS PAGE TO A FRIEND

DNMT1

DNA (cytosine-5-)-methyltransferase 1

104 Gene Product Result for
Synonyms: ADCADN AIM CXXC9 DNMT HSN1E MCMT
UniProtKB ID: P26358, A0AV63, B7ZLW6, Q9UHG5, Q9ULA2, Q9UMZ6
Gene ID:
Human(1786) Summary: DNA (cytosine-5-)-methyltransferase 1 has a role in the establishment and regulation of tissue-specific patterns of methylated cytosine residues. Aberrant methylation patterns are associated with certain human tumors and developmental abnormalities. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(13433) DNA methyltransferase (cytosine-5) 1
Rat(84350) DNA (cytosine-5-)-methyltransferase 1
Zebrafish(30430) DNA (cytosine-5-)-methyltransferase 1
domestic cat(101093502) DNA (cytosine-5-)-methyltransferase 1
dog(476715) DNA (cytosine-5-)-methyltransferase 1
cow(281119) DNA (cytosine-5-)-methyltransferase 1
chicken(396011) DNA (cytosine-5-)-methyltransferase 1
naked mole-rat(101712352) DNA (cytosine-5-)-methyltransferase 1
domestic guinea pig(100717406) DNA (cytosine-5-)-methyltransferase 1
Goat(100861294) DNA (cytosine-5-)-methyltransferase 1
sheep(443549) DNA (cytosine-5-)-methyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22659 Anti-DNMT1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2500321 Anti-DNMT1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, canine, pig, mouse, bovine, human
ELISA, immunohistochemistry, western blot pricing
D4692 Anti-DNMT1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
microarray, western blot pricing
D4567 Anti-DNMT1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, rat
immunofluorescence, microarray, western blot pricing
HPA002694 Anti-DNMT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106406 Anti-DNMT1 antibody produced in rabbit affinity isolated antibody mouse
ELISA, western blot pricing
WH0001786M1 Monoclonal Anti-DNMT1 antibody produced in mouse clone 2B5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403742 Monoclonal Anti-DNMT1, (N-terminal) antibody produced in mouse clone 2B5, ascites fluid human
ELISA, western blot pricing
PLA0011 Rabbit anti-DNMT1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. horse, rhesus monkey, human, pig, chimpanzee, goat, sheep, bovine, primate, gorilla
immunoprecipitation, proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A2385 5-Azacytidine ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001379 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001379 siRNAs that have been validated in the lab human pricing
NM_053354 Rosetta Predictions rat pricing
NM_010066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001379 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204021 validated 2818
2 SASI_Hs01_00204022 predicted 3253
3 SASI_Hs01_00204023 predicted 3491
4 SASI_Hs01_00204024 predicted 3209
5 SASI_Hs01_00204026 predicted 1710
6 SASI_Hs01_00204027 predicted 2883
7 SASI_Hs01_00204028 predicted 474
8 SASI_Hs01_00204029 predicted 2891
9 SASI_Hs01_00204030 predicted 1683
10 SASI_Hs02_00331731 predicted 1556
11 SASI_Hs01_00204025 predicted 1579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111429 predicted 535
2 SASI_Rn01_00111430 predicted 2125
3 SASI_Rn02_00265820 predicted 2133
4 SASI_Rn02_00265821 predicted 4705
5 SASI_Rn01_00111431 predicted 1843
6 SASI_Rn01_00111433 predicted 1223
7 SASI_Rn02_00265822 predicted 1802
8 SASI_Rn01_00111436 predicted 1538
9 SASI_Rn01_00111437 predicted 2061
10 SASI_Rn01_00111438 predicted 902
11 SASI_Rn01_00111432 predicted 1609
12 SASI_Rn01_00111434 predicted 2986
13 SASI_Rn01_00111435 predicted 3072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024007 predicted 1436
2 SASI_Mm02_00317740 predicted 815
3 SASI_Mm01_00024008 predicted 1836
4 SASI_Mm01_00024009 predicted 1617
5 SASI_Mm02_00317741 predicted 2865
6 SASI_Mm01_00024010 predicted 4217
7 SASI_Mm01_00024011 predicted 3786
8 SASI_Mm01_00024012 predicted 325
9 SASI_Mm01_00024014 predicted 3188
10 SASI_Mm01_00024016 predicted 2159
11 SASI_Mm01_00024013 predicted 2900
12 SASI_Mm01_00024015 predicted 1958
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001379
VALIDATED
DNMT1 MISSION shRNA Bacterial Glycerol Stock
DNA (cytosine-5-)-methyltransferase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001379.2-1261s21c1
Sequence:CCGGGACGACCCTGACCTCAAATATCTCGAGATATTTGAGGTCAGGGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001379.2-5202s21c1
Sequence:CCGGATCAAATTGTGCAGTACTTTGCTCGAGCAAAGTACTGCACAATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001379.1-373s21c1
Sequence:CCGGTTGAATCTCTTGCACGAATTTCTCGAGAAATTCGTGCAAGAGATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001379.1-1714s21c1
Sequence:CCGGCCCGAGTATGCGCCCATATTTCTCGAGAAATATGGGCGCATACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001379.1-5229s21c1
Sequence:CCGGGAGGTTCGCTTATCAACTAATCTCGAGATTAGTTGATAAGCGAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001379.1-2340s21c1
Sequence:CCGGCGATGAGGAAGTCGATGATAACTCGAGTTATCATCGACTTCCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001379.2-2788s21c1
Sequence:CCGGGATCAAGACTACGCGAGATTCCTCGAGGAATCTCGCGTAGTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001379.1-1577s1c1
Sequence:CCGGCGTCTCTTGAAGGTGGTGTTACTCGAGTAACACCACCTTCAAGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001379.1-1518s1c1
Sequence:CCGGCGAGAAGAATATCGAACTCTTCTCGAGAAGAGTTCGATATTCTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001379.1-3168s1c1
Sequence:CCGGCGACTACATCAAAGGCAGCAACTCGAGTTGCTGCCTTTGATGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001379.1-3261s1c1
Sequence:CCGGGCCCAATGAGACTGACATCAACTCGAGTTGATGTCAGTCTCATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001379.1-1687s1c1
Sequence:CCGGGCCGAATACATTCTGATGGATCTCGAGATCCATCAGAATGTATTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001379
VALIDATED
DNMT1 MISSION shRNA shRNA Plasmid DNA
DNA (cytosine-5-)-methyltransferase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001379.2-1261s21c1
Sequence:CCGGGACGACCCTGACCTCAAATATCTCGAGATATTTGAGGTCAGGGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001379.2-5202s21c1
Sequence:CCGGATCAAATTGTGCAGTACTTTGCTCGAGCAAAGTACTGCACAATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001379.1-373s21c1
Sequence:CCGGTTGAATCTCTTGCACGAATTTCTCGAGAAATTCGTGCAAGAGATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001379.1-1714s21c1
Sequence:CCGGCCCGAGTATGCGCCCATATTTCTCGAGAAATATGGGCGCATACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001379.1-5229s21c1
Sequence:CCGGGAGGTTCGCTTATCAACTAATCTCGAGATTAGTTGATAAGCGAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001379.1-2340s21c1
Sequence:CCGGCGATGAGGAAGTCGATGATAACTCGAGTTATCATCGACTTCCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001379.2-2788s21c1
Sequence:CCGGGATCAAGACTACGCGAGATTCCTCGAGGAATCTCGCGTAGTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001379.1-1577s1c1
Sequence:CCGGCGTCTCTTGAAGGTGGTGTTACTCGAGTAACACCACCTTCAAGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001379.1-1518s1c1
Sequence:CCGGCGAGAAGAATATCGAACTCTTCTCGAGAAGAGTTCGATATTCTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001379.1-3168s1c1
Sequence:CCGGCGACTACATCAAAGGCAGCAACTCGAGTTGCTGCCTTTGATGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001379.1-3261s1c1
Sequence:CCGGGCCCAATGAGACTGACATCAACTCGAGTTGATGTCAGTCTCATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001379.1-1687s1c1
Sequence:CCGGGCCGAATACATTCTGATGGATCTCGAGATCCATCAGAATGTATTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001379
VALIDATED
DNMT1 MISSION shRNA Lentiviral Transduction Particles
DNA (cytosine-5-)-methyltransferase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001379.2-1261s21c1
Sequence:CCGGGACGACCCTGACCTCAAATATCTCGAGATATTTGAGGTCAGGGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001379.2-5202s21c1
Sequence:CCGGATCAAATTGTGCAGTACTTTGCTCGAGCAAAGTACTGCACAATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001379.1-373s21c1
Sequence:CCGGTTGAATCTCTTGCACGAATTTCTCGAGAAATTCGTGCAAGAGATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001379.1-1714s21c1
Sequence:CCGGCCCGAGTATGCGCCCATATTTCTCGAGAAATATGGGCGCATACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001379.1-5229s21c1
Sequence:CCGGGAGGTTCGCTTATCAACTAATCTCGAGATTAGTTGATAAGCGAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001379.1-2340s21c1
Sequence:CCGGCGATGAGGAAGTCGATGATAACTCGAGTTATCATCGACTTCCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001379.2-2788s21c1
Sequence:CCGGGATCAAGACTACGCGAGATTCCTCGAGGAATCTCGCGTAGTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001379.1-1577s1c1
Sequence:CCGGCGTCTCTTGAAGGTGGTGTTACTCGAGTAACACCACCTTCAAGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001379.1-1518s1c1
Sequence:CCGGCGAGAAGAATATCGAACTCTTCTCGAGAAGAGTTCGATATTCTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001379.1-3168s1c1
Sequence:CCGGCGACTACATCAAAGGCAGCAACTCGAGTTGCTGCCTTTGATGTAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001379.1-3261s1c1
Sequence:CCGGGCCCAATGAGACTGACATCAACTCGAGTTGATGTCAGTCTCATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001379.1-1687s1c1
Sequence:CCGGGCCGAATACATTCTGATGGATCTCGAGATCCATCAGAATGTATTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010066
VALIDATED
DNMT1 MISSION shRNA Bacterial Glycerol Stock
DNA (cytosine-5-)-methyltransferase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010066.3-1442s21c1
Sequence:GTACCGGATCTATGGAAGGTGGTATTAACTCGAGTTAATACCACCTTCCATAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010066.3-5073s21c1
Sequence:CCGGACCAAGCTGTGTAGTACTTTGCTCGAGCAAAGTACTACACAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010066.3-3065s21c1
Sequence:CCGGCTATCGCATCGGTCGGATAAACTCGAGTTTATCCGACCGATGCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010066.3-1669s21c1
Sequence:CCGGTATATGAAGACCTGATCAATACTCGAGTATTGATCAGGTCTTCATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010066.3-1278s21c1
Sequence:CCGGTCGACCTGGTTTGATACTTATCTCGAGATAAGTATCAAACCAGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010066.2-5032s1c1
Sequence:CCGGGCTGACACTAAGCTGTTTGTACTCGAGTACAAACAGCTTAGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010066.2-2921s1c1
Sequence:CCGGGCCTTTACTTTCAACATCAAACTCGAGTTTGATGTTGAAAGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010066.2-1129s1c1
Sequence:CCGGCCCGAAGATCAACTCACCAAACTCGAGTTTGGTGAGTTGATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010066.2-1569s1c1
Sequence:CCGGGCAAAGAGTATGAGCCAATATCTCGAGATATTGGCTCATACTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010066
VALIDATED
DNMT1 MISSION shRNA shRNA Plasmid DNA
DNA (cytosine-5-)-methyltransferase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010066.3-1442s21c1
Sequence:GTACCGGATCTATGGAAGGTGGTATTAACTCGAGTTAATACCACCTTCCATAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010066.3-5073s21c1
Sequence:CCGGACCAAGCTGTGTAGTACTTTGCTCGAGCAAAGTACTACACAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010066.3-3065s21c1
Sequence:CCGGCTATCGCATCGGTCGGATAAACTCGAGTTTATCCGACCGATGCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010066.3-1669s21c1
Sequence:CCGGTATATGAAGACCTGATCAATACTCGAGTATTGATCAGGTCTTCATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010066.3-1278s21c1
Sequence:CCGGTCGACCTGGTTTGATACTTATCTCGAGATAAGTATCAAACCAGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010066.2-5032s1c1
Sequence:CCGGGCTGACACTAAGCTGTTTGTACTCGAGTACAAACAGCTTAGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010066.2-2921s1c1
Sequence:CCGGGCCTTTACTTTCAACATCAAACTCGAGTTTGATGTTGAAAGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010066.2-1129s1c1
Sequence:CCGGCCCGAAGATCAACTCACCAAACTCGAGTTTGGTGAGTTGATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010066.2-1569s1c1
Sequence:CCGGGCAAAGAGTATGAGCCAATATCTCGAGATATTGGCTCATACTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010066
VALIDATED
DNMT1 MISSION shRNA Lentiviral Transduction Particles
DNA (cytosine-5-)-methyltransferase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010066.3-1442s21c1
Sequence:GTACCGGATCTATGGAAGGTGGTATTAACTCGAGTTAATACCACCTTCCATAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010066.3-5073s21c1
Sequence:CCGGACCAAGCTGTGTAGTACTTTGCTCGAGCAAAGTACTACACAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010066.3-3065s21c1
Sequence:CCGGCTATCGCATCGGTCGGATAAACTCGAGTTTATCCGACCGATGCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010066.3-1669s21c1
Sequence:CCGGTATATGAAGACCTGATCAATACTCGAGTATTGATCAGGTCTTCATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010066.3-1278s21c1
Sequence:CCGGTCGACCTGGTTTGATACTTATCTCGAGATAAGTATCAAACCAGGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010066.2-5032s1c1
Sequence:CCGGGCTGACACTAAGCTGTTTGTACTCGAGTACAAACAGCTTAGTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010066.2-2921s1c1
Sequence:CCGGGCCTTTACTTTCAACATCAAACTCGAGTTTGATGTTGAAAGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010066.2-1129s1c1
Sequence:CCGGCCCGAAGATCAACTCACCAAACTCGAGTTTGGTGAGTTGATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010066.2-1569s1c1
Sequence:CCGGGCAAAGAGTATGAGCCAATATCTCGAGATATTGGCTCATACTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks