EMAIL THIS PAGE TO A FRIEND

DNMT3A

DNA (cytosine-5-)-methyltransferase 3 alpha

249 Gene Product Result for
Synonyms: DNMT3A2 M.HsaIIIA
UniProtKB ID: Q9Y6K1, E9PEB8, Q86TE8, Q86XF5, Q8IZV0, Q8WXU9
Gene ID:
Human(1788) Summary: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase that is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes to the cytoplasm and nucleus and its expression is developmentally regulated. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(13435) DNA methyltransferase 3A
Rat(444984) DNA (cytosine-5-)-methyltransferase 3 alpha
chicken(421991) DNA (cytosine-5-)-methyltransferase 3 alpha
dog(482996) DNA (cytosine-5-)-methyltransferase 3 alpha
domestic cat(100510798) DNA (cytosine-5-)-methyltransferase 3 alpha
cow(359716) DNA (cytosine-5-)-methyltransferase 3 alpha
Horse(100055881) DNA (cytosine-5-)-methyltransferase 3 alpha
sheep(100500776) DNA (cytosine-5-)-methyltransferase 3 alpha
Domestic Rabbit(100344715) DNA (cytosine-5-)-methyltransferase 3 alpha
domestic guinea pig(100721625) DNA (cytosine-5-)-methyltransferase 3 alpha
naked mole-rat(101718745) DNA (cytosine-5-)-methyltransferase 3 alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A2385 5-Azacytidine ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022552 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022552 Rosetta Predictions human pricing
NM_153759 Rosetta Predictions human pricing
NM_175629 Rosetta Predictions human pricing
NM_175630 Rosetta Predictions human pricing
NM_001003957 Rosetta Predictions rat pricing
NM_001003958 Rosetta Predictions rat pricing
NM_007872 Rosetta Predictions mouse pricing
NM_153743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160192 predicted 2763
2 SASI_Hs01_00160193 predicted 2063
3 SASI_Hs01_00160194 predicted 1653
4 SASI_Hs01_00160195 predicted 2212
5 SASI_Hs01_00160196 predicted 2379
6 SASI_Hs01_00160197 predicted 1253
7 SASI_Hs02_00355826 predicted 2745
8 SASI_Hs02_00355827 predicted 2589
9 SASI_Hs01_00160198 predicted 1358
10 SASI_Hs01_00160199 predicted 2638
11 SASI_Hs01_00160200 predicted 2451
12 SASI_Hs01_00160201 predicted 2228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124267 predicted 2053
2 SASI_Hs01_00124268 predicted 1361
3 SASI_Hs01_00124269 predicted 942
4 SASI_Hs01_00124270 predicted 1501
5 SASI_Hs01_00124271 predicted 1671
6 SASI_Hs01_00124272 predicted 541
7 SASI_Hs02_00367470 predicted 2038
8 SASI_Hs02_00367471 predicted 1872
9 SASI_Hs01_00124273 predicted 649
10 SASI_Hs01_00124274 predicted 1927
11 SASI_Hs01_00124275 predicted 1744
12 SASI_Hs01_00124276 predicted 1524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225484 predicted 2843
2 SASI_Hs01_00225485 predicted 2150
3 SASI_Hs01_00225486 predicted 1741
4 SASI_Hs01_00225487 predicted 2293
5 SASI_Hs01_00225488 predicted 2465
6 SASI_Hs01_00225489 predicted 1337
7 SASI_Hs02_00369021 predicted 2832
8 SASI_Hs02_00369022 predicted 2668
9 SASI_Hs01_00225490 predicted 1440
10 SASI_Hs01_00225491 predicted 2723
11 SASI_Hs01_00225492 predicted 2541
12 SASI_Hs01_00225493 predicted 2313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165161 predicted 1309
2 SASI_Hs02_00369023 predicted 876
3 SASI_Hs02_00369024 predicted 840
4 SASI_Hs02_00369025 predicted 1313
5 SASI_Hs01_00165163 predicted 1662
6 SASI_Hs02_00369026 predicted 1642
7 SASI_Hs01_00165164 predicted 1373
8 SASI_Hs01_00165167 predicted 1714
9 SASI_Hs01_00165168 predicted 1438
10 SASI_Hs01_00165169 predicted 1686
11 SASI_Hs01_00165162 predicted 1326
12 SASI_Hs01_00165165 predicted 1665
13 SASI_Hs01_00165166 predicted 1486
14 SASI_Hs01_00165170 predicted 1478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111288 predicted 1299
2 SASI_Rn01_00111289 predicted 938
3 SASI_Rn01_00111290 predicted 629
4 SASI_Rn01_00111291 predicted 1384
5 SASI_Rn01_00111292 predicted 1918
6 SASI_Rn01_00111293 predicted 1382
7 SASI_Rn01_00111294 predicted 1285
8 SASI_Rn01_00111295 predicted 991
9 SASI_Rn01_00111297 predicted 841
10 SASI_Rn02_00198072 predicted 1942
11 SASI_Rn01_00111296 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078050 predicted 1984
2 SASI_Rn01_00078051 predicted 1614
3 SASI_Rn01_00078052 predicted 1312
4 SASI_Rn01_00078053 predicted 2066
5 SASI_Rn01_00078054 predicted 2594
6 SASI_Rn01_00078055 predicted 2067
7 SASI_Rn01_00078056 predicted 1972
8 SASI_Rn01_00078057 predicted 1672
9 SASI_Rn01_00078059 predicted 1524
10 SASI_Rn02_00198073 predicted 2624
11 SASI_Rn01_00078058 predicted 2284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201687 predicted 2813
2 SASI_Mm01_00201688 predicted 1699
3 SASI_Mm01_00201690 predicted 1222
4 SASI_Mm01_00201691 predicted 2791
5 SASI_Mm01_00201692 predicted 2125
6 SASI_Mm01_00201693 predicted 1683
7 SASI_Mm01_00201694 predicted 2275
8 SASI_Mm02_00312657 predicted 1444
9 SASI_Mm02_00312658 predicted 2425
10 SASI_Mm01_00201696 predicted 2490
11 SASI_Mm01_00201689 predicted 2094
12 SASI_Mm01_00201695 predicted 2526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051797 predicted 1987
2 SASI_Mm01_00051798 predicted 877
3 SASI_Mm01_00051800 predicted 394
4 SASI_Mm01_00051801 predicted 1965
5 SASI_Mm01_00051802 predicted 1304
6 SASI_Mm01_00051803 predicted 853
7 SASI_Mm01_00051804 predicted 1448
8 SASI_Mm02_00343467 predicted 614
9 SASI_Mm02_00343468 predicted 1602
10 SASI_Mm01_00051806 predicted 1667
11 SASI_Mm01_00051799 predicted 1391
12 SASI_Mm01_00051805 predicted 1823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022552
VALIDATED
DNMT3A MISSION shRNA Bacterial Glycerol Stock
DNA (cytosine-5-)-methyltransferase 3 alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_022552.3-1650s1c1
Sequence:CCGGCCCAAGGTCAAGGAGATTATTCTCGAGAATAATCTCCTTGACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_022552.3-2441s1c1
Sequence:CCGGCCGGCTCTTCTTTGAGTTCTACTCGAGTAGAACTCAAAGAAGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_022552.3-1527s1c1
Sequence:CCGGCCACCAGAAGAAGAGAAGAATCTCGAGATTCTTCTCTTCTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_022552.3-507s1c1
Sequence:CCGGGCCTCAGAGCTATTACCCAATCTCGAGATTGGGTAATAGCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022552.3-2322s21c1
Sequence:CCGGAGCGTCACACAGAAGCATATCCTCGAGGATATGCTTCTGTGTGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022552.3-3017s21c1
Sequence:CCGGGGTAGCGACACAAAGTTAAACCTCGAGGTTTAACTTTGTGTCGCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022552.3-2071s21c1
Sequence:CCGGTCCAGATGTTCTTCGCTAATACTCGAGTATTAGCGAAGAACATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022552.3-2963s21c1
Sequence:CCGGCGCTCCGCTGAAGGAGTATTTCTCGAGAAATACTCCTTCAGCGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022552.3-2672s21c1
Sequence:CCGGGGCATCCACTGTGAATGATAACTCGAGTTATCATTCACAGTGGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022552
VALIDATED
DNMT3A MISSION shRNA shRNA Plasmid DNA
DNA (cytosine-5-)-methyltransferase 3 alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_022552.3-1650s1c1
Sequence:CCGGCCCAAGGTCAAGGAGATTATTCTCGAGAATAATCTCCTTGACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_022552.3-2441s1c1
Sequence:CCGGCCGGCTCTTCTTTGAGTTCTACTCGAGTAGAACTCAAAGAAGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_022552.3-1527s1c1
Sequence:CCGGCCACCAGAAGAAGAGAAGAATCTCGAGATTCTTCTCTTCTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_022552.3-507s1c1
Sequence:CCGGGCCTCAGAGCTATTACCCAATCTCGAGATTGGGTAATAGCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022552.3-2322s21c1
Sequence:CCGGAGCGTCACACAGAAGCATATCCTCGAGGATATGCTTCTGTGTGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022552.3-3017s21c1
Sequence:CCGGGGTAGCGACACAAAGTTAAACCTCGAGGTTTAACTTTGTGTCGCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022552.3-2071s21c1
Sequence:CCGGTCCAGATGTTCTTCGCTAATACTCGAGTATTAGCGAAGAACATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022552.3-2963s21c1
Sequence:CCGGCGCTCCGCTGAAGGAGTATTTCTCGAGAAATACTCCTTCAGCGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022552.3-2672s21c1
Sequence:CCGGGGCATCCACTGTGAATGATAACTCGAGTTATCATTCACAGTGGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022552
VALIDATED
DNMT3A MISSION shRNA Lentiviral Transduction Particles
DNA (cytosine-5-)-methyltransferase 3 alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_022552.3-1650s1c1
Sequence:CCGGCCCAAGGTCAAGGAGATTATTCTCGAGAATAATCTCCTTGACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_022552.3-2441s1c1
Sequence:CCGGCCGGCTCTTCTTTGAGTTCTACTCGAGTAGAACTCAAAGAAGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_022552.3-1527s1c1
Sequence:CCGGCCACCAGAAGAAGAGAAGAATCTCGAGATTCTTCTCTTCTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_022552.3-507s1c1
Sequence:CCGGGCCTCAGAGCTATTACCCAATCTCGAGATTGGGTAATAGCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022552.3-2322s21c1
Sequence:CCGGAGCGTCACACAGAAGCATATCCTCGAGGATATGCTTCTGTGTGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022552.3-3017s21c1
Sequence:CCGGGGTAGCGACACAAAGTTAAACCTCGAGGTTTAACTTTGTGTCGCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022552.3-2071s21c1
Sequence:CCGGTCCAGATGTTCTTCGCTAATACTCGAGTATTAGCGAAGAACATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022552.3-2963s21c1
Sequence:CCGGCGCTCCGCTGAAGGAGTATTTCTCGAGAAATACTCCTTCAGCGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022552.3-2672s21c1
Sequence:CCGGGGCATCCACTGTGAATGATAACTCGAGTTATCATTCACAGTGGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007872
VALIDATED
DNMT3A MISSION shRNA Bacterial Glycerol Stock
DNA (cytosine-5-)-methyltransferase 3 alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007872.2-638s1c1
Sequence:CCGGGCAGACCAACATCGAATCCATCTCGAGATGGATTCGATGTTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007872.2-2677s1c1
Sequence:CCGGCCACCAGGTCAAACTCTATAACTCGAGTTATAGAGTTTGACCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007872.2-1718s1c1
Sequence:CCGGCCAGAACTGTAAGAACTGCTTCTCGAGAAGCAGTTCTTACAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007872.2-1991s1c1
Sequence:CCGGCCAGATGTTCTTTGCCAATAACTCGAGTTATTGGCAAAGAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007872.2-2505s1c1
Sequence:CCGGCCCGTGATGATTGACGCCAAACTCGAGTTTGGCGTCAATCATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007872.4-4452s21c1
Sequence:CCGGCTTATGGTTCTGGCTATAATTCTCGAGAATTATAGCCAGAACCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007872.4-3006s21c1
Sequence:CCGGCGCTCCGCTGAAGGAATATTTCTCGAGAAATATTCCTTCAGCGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007872.4-2800s21c1
Sequence:CCGGACCACCAGGTCAAACTCTATACTCGAGTATAGAGTTTGACCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007872.4-2597s21c1
Sequence:CCGGAGAGGGACATCTCGCGATTTCCTCGAGGAAATCGCGAGATGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007872.4-2046s21c1
Sequence:CCGGCTGCTACATGTGCGGGCATAACTCGAGTTATGCCCGCACATGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007872
VALIDATED
DNMT3A MISSION shRNA shRNA Plasmid DNA
DNA (cytosine-5-)-methyltransferase 3 alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007872.2-638s1c1
Sequence:CCGGGCAGACCAACATCGAATCCATCTCGAGATGGATTCGATGTTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007872.2-2677s1c1
Sequence:CCGGCCACCAGGTCAAACTCTATAACTCGAGTTATAGAGTTTGACCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007872.2-1718s1c1
Sequence:CCGGCCAGAACTGTAAGAACTGCTTCTCGAGAAGCAGTTCTTACAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007872.2-1991s1c1
Sequence:CCGGCCAGATGTTCTTTGCCAATAACTCGAGTTATTGGCAAAGAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007872.2-2505s1c1
Sequence:CCGGCCCGTGATGATTGACGCCAAACTCGAGTTTGGCGTCAATCATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007872.4-4452s21c1
Sequence:CCGGCTTATGGTTCTGGCTATAATTCTCGAGAATTATAGCCAGAACCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007872.4-3006s21c1
Sequence:CCGGCGCTCCGCTGAAGGAATATTTCTCGAGAAATATTCCTTCAGCGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007872.4-2800s21c1
Sequence:CCGGACCACCAGGTCAAACTCTATACTCGAGTATAGAGTTTGACCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007872.4-2597s21c1
Sequence:CCGGAGAGGGACATCTCGCGATTTCCTCGAGGAAATCGCGAGATGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007872.4-2046s21c1
Sequence:CCGGCTGCTACATGTGCGGGCATAACTCGAGTTATGCCCGCACATGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007872
VALIDATED
DNMT3A MISSION shRNA Lentiviral Transduction Particles
DNA (cytosine-5-)-methyltransferase 3 alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007872.2-638s1c1
Sequence:CCGGGCAGACCAACATCGAATCCATCTCGAGATGGATTCGATGTTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007872.2-2677s1c1
Sequence:CCGGCCACCAGGTCAAACTCTATAACTCGAGTTATAGAGTTTGACCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007872.2-1718s1c1
Sequence:CCGGCCAGAACTGTAAGAACTGCTTCTCGAGAAGCAGTTCTTACAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007872.2-1991s1c1
Sequence:CCGGCCAGATGTTCTTTGCCAATAACTCGAGTTATTGGCAAAGAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007872.2-2505s1c1
Sequence:CCGGCCCGTGATGATTGACGCCAAACTCGAGTTTGGCGTCAATCATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007872.4-4452s21c1
Sequence:CCGGCTTATGGTTCTGGCTATAATTCTCGAGAATTATAGCCAGAACCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007872.4-3006s21c1
Sequence:CCGGCGCTCCGCTGAAGGAATATTTCTCGAGAAATATTCCTTCAGCGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007872.4-2800s21c1
Sequence:CCGGACCACCAGGTCAAACTCTATACTCGAGTATAGAGTTTGACCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007872.4-2597s21c1
Sequence:CCGGAGAGGGACATCTCGCGATTTCCTCGAGGAAATCGCGAGATGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007872.4-2046s21c1
Sequence:CCGGCTGCTACATGTGCGGGCATAACTCGAGTTATGCCCGCACATGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks