EMAIL THIS PAGE TO A FRIEND

DNMT3B

DNA (cytosine-5-)-methyltransferase 3 beta

202 Gene Product Result for
Synonyms: ICF ICF1 M.HsaIIIB
Gene ID:
Human(1789) Summary: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a DNA methyltransferase which is thought to function in de novo methylation, rather than maintenance methylation. The protein localizes primarily to the nucleus and its expression is developmentally regulated. Mutations in this gene cause the immunodeficiency-centromeric instability-facial anomalies (ICF) syndrome. Eight alternatively spliced transcript variants have been described. The full length sequences of variants 4 and 5 have not been determined. [provided by RefSeq, May 2011]
Mouse(13436) DNA methyltransferase 3B
Rat(444985) DNA (cytosine-5-)-methyltransferase 3 beta
Zebrafish(321084) DNA (cytosine-5-)-methyltransferase 3 beta
cow(353354) DNA (cytosine-5-)-methyltransferase 3 beta
Horse(100053900) DNA (cytosine-5-)-methyltransferase 3 beta
chicken(419287) DNA (cytosine-5-)-methyltransferase 3 beta
dog(100685634) DNA (cytosine-5-)-methyltransferase 3 beta
domestic cat(101092926) DNA (cytosine-5-)-methyltransferase 3 beta
sheep(100500777) DNA (cytosine-5-)-methyltransferase 3 beta
Domestic Rabbit(100349823) DNA (cytosine-5-)-methyltransferase 3 beta
naked mole-rat(101725788) DNA (cytosine-5-)-methyltransferase 3 beta
domestic guinea pig(100731772) DNA (cytosine-5-)-methyltransferase 3 beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A2385 5-Azacytidine ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006892 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003960 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003960 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003960 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158451 MISSION® esiRNA esiRNA human DNMT3B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006892 Rosetta Predictions human pricing
NM_175848 Rosetta Predictions human pricing
NM_175849 Rosetta Predictions human pricing
NM_175850 Rosetta Predictions human pricing
NM_001003959 Rosetta Predictions rat pricing
XM_001061716 Rosetta Predictions rat pricing
XM_001061767 Rosetta Predictions rat pricing
XM_001061821 Rosetta Predictions rat pricing
XM_001061879 Rosetta Predictions rat pricing
NM_001003960 Rosetta Predictions mouse pricing
NM_001003961 Rosetta Predictions mouse pricing
NM_001003963 Rosetta Predictions mouse pricing
NM_001122997 Rosetta Predictions mouse pricing
NM_010068 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016756 predicted 513
2 SASI_Hs01_00016757 predicted 2104
3 SASI_Hs01_00016758 predicted 2292
4 SASI_Hs01_00016759 predicted 2080
5 SASI_Hs01_00016760 predicted 2197
6 SASI_Hs01_00016761 predicted 2262
7 SASI_Hs01_00016763 predicted 2037
8 SASI_Hs01_00016764 predicted 1741
9 SASI_Hs01_00016765 predicted 620
10 SASI_Hs02_00342565 predicted 2101
11 SASI_Hs01_00016762 predicted 1739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171310 predicted 511
2 SASI_Hs01_00171311 predicted 2041
3 SASI_Hs01_00171312 predicted 2237
4 SASI_Hs01_00171313 predicted 2015
5 SASI_Hs01_00171314 predicted 2134
6 SASI_Hs01_00171315 predicted 2208
7 SASI_Hs01_00171317 predicted 1979
8 SASI_Hs01_00171318 predicted 1676
9 SASI_Hs01_00171319 predicted 623
10 SASI_Hs02_00369125 predicted 2038
11 SASI_Hs01_00171316 predicted 1679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022971 predicted 515
2 SASI_Hs01_00022972 predicted 2044
3 SASI_Hs01_00022973 predicted 2233
4 SASI_Hs01_00022974 predicted 2016
5 SASI_Hs01_00022975 predicted 2131
6 SASI_Hs01_00022976 predicted 2199
7 SASI_Hs01_00022978 predicted 1978
8 SASI_Hs01_00022979 predicted 1683
9 SASI_Hs01_00022980 predicted 623
10 SASI_Hs02_00369126 predicted 2039
11 SASI_Hs01_00022977 predicted 1679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149304 predicted 497
2 SASI_Hs01_00149305 predicted 2022
3 SASI_Hs01_00149306 predicted 2214
4 SASI_Hs01_00149307 predicted 1996
5 SASI_Hs01_00149308 predicted 2111
6 SASI_Hs01_00149309 predicted 2186
7 SASI_Hs01_00149311 predicted 1959
8 SASI_Hs01_00149312 predicted 1654
9 SASI_Hs01_00149313 predicted 604
10 SASI_Hs02_00369127 predicted 2017
11 SASI_Hs01_00149310 predicted 1661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040785 predicted 457
2 SASI_Rn01_00040786 predicted 454
3 SASI_Rn01_00040787 predicted 2511
4 SASI_Rn01_00040789 predicted 1477
5 SASI_Rn01_00040790 predicted 691
6 SASI_Rn01_00040791 predicted 689
7 SASI_Rn02_00198074 predicted 2337
8 SASI_Rn01_00040792 predicted 552
9 SASI_Rn01_00040793 predicted 420
10 SASI_Rn01_00040794 predicted 2964
11 SASI_Rn01_00040788 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301112 predicted 669
2 SASI_Rn02_00301113 predicted 2103
3 SASI_Rn02_00301114 predicted 1967
4 SASI_Rn02_00301115 predicted 2114
5 SASI_Rn02_00301116 predicted 1064
6 SASI_Rn02_00301117 predicted 280
7 SASI_Rn02_00301118 predicted 277
8 SASI_Rn02_00301119 predicted 1931
9 SASI_Rn02_00301120 predicted 2004
10 SASI_Rn02_00301121 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301275 predicted 2100
2 SASI_Rn02_00301276 predicted 1065
3 SASI_Rn02_00301277 predicted 287
4 SASI_Rn02_00301278 predicted 279
5 SASI_Rn02_00301279 predicted 1932
6 SASI_Rn02_00301280 predicted 2559
7 SASI_Rn02_00301281 predicted 2267
8 SASI_Rn02_00301282 predicted 2315
9 SASI_Rn02_00301283 predicted 2274
10 SASI_Rn02_00301284 predicted 1684
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061821 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301428 predicted 2092
2 SASI_Rn02_00301429 predicted 336
3 SASI_Rn02_00301430 predicted 330
4 SASI_Rn02_00301431 predicted 1921
5 SASI_Rn02_00301432 predicted 2541
6 SASI_Rn02_00301433 predicted 2247
7 SASI_Rn02_00301434 predicted 2304
8 SASI_Rn02_00301435 predicted 2268
9 SASI_Rn02_00301436 predicted 1673
10 SASI_Rn02_00301437 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061879 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301614 predicted 667
2 SASI_Rn02_00301615 predicted 2045
3 SASI_Rn02_00301616 predicted 1903
4 SASI_Rn02_00301617 predicted 2057
5 SASI_Rn02_00301618 predicted 284
6 SASI_Rn02_00301619 predicted 277
7 SASI_Rn02_00301620 predicted 1877
8 SASI_Rn02_00301621 predicted 2025
9 SASI_Rn02_00301622 predicted 1947
10 SASI_Rn02_00301623 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286412 predicted 1267
2 SASI_Mm02_00286413 predicted 680
3 SASI_Mm01_00032306 predicted 2308
4 SASI_Mm02_00286414 predicted 2362
5 SASI_Mm02_00286415 predicted 1815
6 SASI_Mm02_00286416 predicted 854
7 SASI_Mm02_00286417 predicted 3021
8 SASI_Mm02_00286418 predicted 762
9 SASI_Mm01_00032310 predicted 1082
10 SASI_Mm02_00286419 predicted 1147
11 SASI_Mm01_00032303 predicted 670
12 SASI_Mm01_00032304 predicted 1091
13 SASI_Mm01_00032305 predicted 1281
14 SASI_Mm01_00032307 predicted 2318
15 SASI_Mm01_00032308 predicted 695
16 SASI_Mm01_00032309 predicted 1061
17 SASI_Mm01_00032311 predicted 1074
18 SASI_Mm01_00032312 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003961 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286420 predicted 1271
2 SASI_Mm02_00286421 predicted 685
3 SASI_Mm01_00138603 predicted 2367
4 SASI_Mm02_00286422 predicted 2422
5 SASI_Mm02_00286423 predicted 1878
6 SASI_Mm02_00286424 predicted 848
7 SASI_Mm02_00286425 predicted 3081
8 SASI_Mm02_00286426 predicted 755
9 SASI_Mm01_00138607 predicted 1080
10 SASI_Mm02_00286427 predicted 1154
11 SASI_Mm01_00138600 predicted 670
12 SASI_Mm01_00138601 predicted 1082
13 SASI_Mm01_00138602 predicted 1274
14 SASI_Mm01_00138604 predicted 2378
15 SASI_Mm01_00138605 predicted 695
16 SASI_Mm01_00138606 predicted 1056
17 SASI_Mm01_00138608 predicted 1073
18 SASI_Mm01_00138609 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286428 predicted 1271
2 SASI_Mm02_00286429 predicted 684
3 SASI_Mm01_00047248 predicted 2366
4 SASI_Mm02_00286430 predicted 2423
5 SASI_Mm02_00286431 predicted 1870
6 SASI_Mm02_00286432 predicted 855
7 SASI_Mm02_00286433 predicted 2900
8 SASI_Mm02_00286434 predicted 757
9 SASI_Mm01_00047252 predicted 1074
10 SASI_Mm02_00286435 predicted 1147
11 SASI_Mm01_00047245 predicted 664
12 SASI_Mm01_00047246 predicted 1085
13 SASI_Mm01_00047247 predicted 1271
14 SASI_Mm01_00047249 predicted 2378
15 SASI_Mm01_00047250 predicted 699
16 SASI_Mm01_00047251 predicted 1055
17 SASI_Mm01_00047253 predicted 1075
18 SASI_Mm01_00047254 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122997 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309759 predicted 1151
2 SASI_Mm02_00309760 predicted 562
3 SASI_Mm02_00309761 predicted 2258
4 SASI_Mm02_00309762 predicted 2310
5 SASI_Mm02_00309763 predicted 1754
6 SASI_Mm02_00309764 predicted 739
7 SASI_Mm02_00309765 predicted 2978
8 SASI_Mm02_00309766 predicted 644
9 SASI_Mm02_00309767 predicted 963
10 SASI_Mm02_00309768 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317744 predicted 1265
2 SASI_Mm02_00317745 predicted 678
3 SASI_Mm01_00097950 predicted 2309
4 SASI_Mm02_00317746 predicted 2362
5 SASI_Mm02_00317747 predicted 1811
6 SASI_Mm02_00317748 predicted 857
7 SASI_Mm02_00317749 predicted 2837
8 SASI_Mm02_00317750 predicted 762
9 SASI_Mm01_00097954 predicted 1073
10 SASI_Mm02_00317751 predicted 1151
11 SASI_Mm01_00097947 predicted 663
12 SASI_Mm01_00097948 predicted 1089
13 SASI_Mm01_00097949 predicted 1271
14 SASI_Mm01_00097951 predicted 2324
15 SASI_Mm01_00097952 predicted 697
16 SASI_Mm01_00097953 predicted 1061
17 SASI_Mm01_00097955 predicted 1072
18 SASI_Mm01_00097956 predicted 1219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006892
DNMT3B MISSION shRNA Bacterial Glycerol Stock
DNA (cytosine-5-)-methyltransferase 3 beta
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006892.3-3235s21c1
Sequence:CCGGAGTGCCGACAGCTCTCCAATACTCGAGTATTGGAGAGCTGTCGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006892.3-1732s21c1
Sequence:CCGGGACGATGGCTATCAGTCTTACCTCGAGGTAAGACTGATAGCCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006892.3-1376s21c1
Sequence:CCGGACACGCAACCAGTGGTTAATACTCGAGTATTAACCACTGGTTGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006892.3-3105s21c1
Sequence:CCGGAGCCTAACACGGTGCTCATTTCTCGAGAAATGAGCACCGTGTTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006892.3-2607s21c1
Sequence:CCGGCAATAGGATAGCCAAGTTAAACTCGAGTTTAACTTGGCTATCCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006892.3-624s21c1
Sequence:CCGGAGCTGTCCGAACTCGAAATAACTCGAGTTATTTCGAGTTCGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006892.3-2452s21c1
Sequence:CCGGTCACGGTTCCTGGAGTGTAATCTCGAGATTACACTCCAGGAACCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006892.3-1414s1c1
Sequence:CCGGGCAGGCAGTAGGAAATTAGAACTCGAGTTCTAATTTCCTACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006892.3-2553s1c1
Sequence:CCGGGCCCGTGATAGCATCAAAGAACTCGAGTTCTTTGATGCTATCACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006892.3-2269s1c1
Sequence:CCGGCCATGCAACGATCTCTCAAATCTCGAGATTTGAGAGATCGTTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006892.3-1514s1c1
Sequence:CCGGGCCTCAAGACAAATTGCTATACTCGAGTATAGCAATTTGTCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006892.3-2052s1c1
Sequence:CCGGCCTGTCATTGTTTGATGGCATCTCGAGATGCCATCAAACAATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006892
DNMT3B MISSION shRNA shRNA Plasmid DNA
DNA (cytosine-5-)-methyltransferase 3 beta
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006892.3-3235s21c1
Sequence:CCGGAGTGCCGACAGCTCTCCAATACTCGAGTATTGGAGAGCTGTCGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006892.3-1732s21c1
Sequence:CCGGGACGATGGCTATCAGTCTTACCTCGAGGTAAGACTGATAGCCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006892.3-1376s21c1
Sequence:CCGGACACGCAACCAGTGGTTAATACTCGAGTATTAACCACTGGTTGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006892.3-3105s21c1
Sequence:CCGGAGCCTAACACGGTGCTCATTTCTCGAGAAATGAGCACCGTGTTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006892.3-2607s21c1
Sequence:CCGGCAATAGGATAGCCAAGTTAAACTCGAGTTTAACTTGGCTATCCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006892.3-624s21c1
Sequence:CCGGAGCTGTCCGAACTCGAAATAACTCGAGTTATTTCGAGTTCGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006892.3-2452s21c1
Sequence:CCGGTCACGGTTCCTGGAGTGTAATCTCGAGATTACACTCCAGGAACCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006892.3-1414s1c1
Sequence:CCGGGCAGGCAGTAGGAAATTAGAACTCGAGTTCTAATTTCCTACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006892.3-2553s1c1
Sequence:CCGGGCCCGTGATAGCATCAAAGAACTCGAGTTCTTTGATGCTATCACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006892.3-2269s1c1
Sequence:CCGGCCATGCAACGATCTCTCAAATCTCGAGATTTGAGAGATCGTTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006892.3-1514s1c1
Sequence:CCGGGCCTCAAGACAAATTGCTATACTCGAGTATAGCAATTTGTCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006892.3-2052s1c1
Sequence:CCGGCCTGTCATTGTTTGATGGCATCTCGAGATGCCATCAAACAATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006892
DNMT3B MISSION shRNA Lentiviral Transduction Particles
DNA (cytosine-5-)-methyltransferase 3 beta
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006892.3-3235s21c1
Sequence:CCGGAGTGCCGACAGCTCTCCAATACTCGAGTATTGGAGAGCTGTCGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006892.3-1732s21c1
Sequence:CCGGGACGATGGCTATCAGTCTTACCTCGAGGTAAGACTGATAGCCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006892.3-1376s21c1
Sequence:CCGGACACGCAACCAGTGGTTAATACTCGAGTATTAACCACTGGTTGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006892.3-3105s21c1
Sequence:CCGGAGCCTAACACGGTGCTCATTTCTCGAGAAATGAGCACCGTGTTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006892.3-2607s21c1
Sequence:CCGGCAATAGGATAGCCAAGTTAAACTCGAGTTTAACTTGGCTATCCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006892.3-624s21c1
Sequence:CCGGAGCTGTCCGAACTCGAAATAACTCGAGTTATTTCGAGTTCGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006892.3-2452s21c1
Sequence:CCGGTCACGGTTCCTGGAGTGTAATCTCGAGATTACACTCCAGGAACCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006892.3-1414s1c1
Sequence:CCGGGCAGGCAGTAGGAAATTAGAACTCGAGTTCTAATTTCCTACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006892.3-2553s1c1
Sequence:CCGGGCCCGTGATAGCATCAAAGAACTCGAGTTCTTTGATGCTATCACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006892.3-2269s1c1
Sequence:CCGGCCATGCAACGATCTCTCAAATCTCGAGATTTGAGAGATCGTTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006892.3-1514s1c1
Sequence:CCGGGCCTCAAGACAAATTGCTATACTCGAGTATAGCAATTTGTCTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006892.3-2052s1c1
Sequence:CCGGCCTGTCATTGTTTGATGGCATCTCGAGATGCCATCAAACAATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003960
DNMT3B MISSION shRNA Bacterial Glycerol Stock
DNA (cytosine-5-)-methyltransferase 3 beta
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000071068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003960.1-3463s1c1
Sequence:CCGGCCAGGAGTATTTGAAGATGATCTCGAGATCATCTTCAAATACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003960.1-695s1c1
Sequence:CCGGGCTCTGATATTCTAATGCCAACTCGAGTTGGCATTAGAATATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003960.1-2487s1c1
Sequence:CCGGCAAGAAAGACATCTCAAGATTCTCGAGAATCTTGAGATGTCTTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003960.1-1287s1c1
Sequence:CCGGGCACTTTAATCTGGCTACCTTCTCGAGAAGGTAGCCAGATTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003960
DNMT3B MISSION shRNA shRNA Plasmid DNA
DNA (cytosine-5-)-methyltransferase 3 beta
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000071068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003960.1-3463s1c1
Sequence:CCGGCCAGGAGTATTTGAAGATGATCTCGAGATCATCTTCAAATACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003960.1-695s1c1
Sequence:CCGGGCTCTGATATTCTAATGCCAACTCGAGTTGGCATTAGAATATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003960.1-2487s1c1
Sequence:CCGGCAAGAAAGACATCTCAAGATTCTCGAGAATCTTGAGATGTCTTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003960.1-1287s1c1
Sequence:CCGGGCACTTTAATCTGGCTACCTTCTCGAGAAGGTAGCCAGATTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003960
DNMT3B MISSION shRNA Lentiviral Transduction Particles
DNA (cytosine-5-)-methyltransferase 3 beta
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000071068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003960.1-3463s1c1
Sequence:CCGGCCAGGAGTATTTGAAGATGATCTCGAGATCATCTTCAAATACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003960.1-695s1c1
Sequence:CCGGGCTCTGATATTCTAATGCCAACTCGAGTTGGCATTAGAATATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003960.1-2487s1c1
Sequence:CCGGCAAGAAAGACATCTCAAGATTCTCGAGAATCTTGAGATGTCTTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003960.1-1287s1c1
Sequence:CCGGGCACTTTAATCTGGCTACCTTCTCGAGAAGGTAGCCAGATTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks