EMAIL THIS PAGE TO A FRIEND

DNMT3L

DNA (cytosine-5-)-methyltransferase 3-like

93 Gene Product Result for
UniProtKB ID: Q9UJW3, E9PB42, Q9BUJ4
Gene ID:
Human(29947) Summary: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a nuclear protein with similarity to DNA methyltransferases, but is not thought to function as a DNA methyltransferase as it does not contain the amino acid residues necessary for methyltransferase activity. However, it does stimulate de novo methylation by DNA cytosine methyltransferase 3 alpha and is thought to be required for the establishment of maternal genomic imprints. This protein also mediates transcriptional repression through interaction with histone deacetylase 1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
Mouse(54427) DNA (cytosine-5-)-methyltransferase 3-like
Rat(309680) DNA (cytosine-5-)-methyltransferase 3-like
domestic guinea pig(100729608) DNA (cytosine-5-)-methyltransferase 3-like
naked mole-rat(101719207) DNA (cytosine-5-)-methyltransferase 3-like
sheep(101102451) DNA (cytosine-5-)-methyltransferase 3-like
dog(608536) DNA (cytosine-5-)-methyltransferase 3-like
domestic cat(101091300) DNA (cytosine-5-)-methyltransferase 3-like
cow(613785) DNA (cytosine-5-)-methyltransferase 3-like
Horse(100050680) DNA (cytosine-5-)-methyltransferase 3-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU022701 MISSION® esiRNA esiRNA targeting mouse Dnmt3l (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013369 Rosetta Predictions human pricing
NM_175867 Rosetta Predictions human pricing
NM_001003964 Rosetta Predictions rat pricing
XM_579110 Rosetta Predictions rat pricing
NM_001081695 Rosetta Predictions mouse pricing
NM_019448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046138 predicted 819
2 SASI_Hs01_00046139 predicted 808
3 SASI_Hs01_00046140 predicted 579
4 SASI_Hs01_00046142 predicted 1139
5 SASI_Hs01_00046143 predicted 1251
6 SASI_Hs01_00046144 predicted 617
7 SASI_Hs01_00046145 predicted 751
8 SASI_Hs01_00046146 predicted 1185
9 SASI_Hs01_00046147 predicted 889
10 SASI_Hs02_00344710 predicted 1021
11 SASI_Hs01_00046141 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033732 predicted 820
2 SASI_Hs01_00033733 predicted 813
3 SASI_Hs01_00033734 predicted 584
4 SASI_Hs01_00033736 predicted 1139
5 SASI_Hs01_00033737 predicted 1246
6 SASI_Hs01_00033738 predicted 613
7 SASI_Hs01_00033739 predicted 756
8 SASI_Hs01_00033740 predicted 1183
9 SASI_Hs01_00033741 predicted 889
10 SASI_Hs02_00369144 predicted 1013
11 SASI_Hs01_00033735 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198075 predicted 1309
2 SASI_Rn01_00038199 predicted 1426
3 SASI_Rn01_00038200 predicted 1128
4 SASI_Rn01_00038201 predicted 489
5 SASI_Rn01_00038202 predicted 841
6 SASI_Rn01_00038203 predicted 570
7 SASI_Rn01_00038204 predicted 987
8 SASI_Rn01_00038205 predicted 272
9 SASI_Rn01_00038206 predicted 1355
10 SASI_Rn01_00038207 predicted 1096
11 SASI_Rn01_00038208 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168842 predicted 1139
2 SASI_Rn01_00168843 predicted 490
3 SASI_Rn01_00168844 predicted 840
4 SASI_Rn01_00168845 predicted 576
5 SASI_Rn01_00168846 predicted 993
6 SASI_Rn01_00168847 predicted 1365
7 SASI_Rn01_00168848 predicted 834
8 SASI_Rn01_00168849 predicted 594
9 SASI_Rn01_00168850 predicted 1100
10 SASI_Rn01_00168851 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299031 predicted 1279
2 SASI_Mm02_00299032 predicted 657
3 SASI_Mm02_00299033 predicted 988
4 SASI_Mm02_00299034 predicted 484
5 SASI_Mm02_00299035 predicted 714
6 SASI_Mm02_00299036 predicted 1401
7 SASI_Mm02_00299037 predicted 1332
8 SASI_Mm02_00299038 predicted 1556
9 SASI_Mm02_00299039 predicted 1578
10 SASI_Mm02_00299040 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109163 predicted 1129
2 SASI_Mm01_00109164 predicted 506
3 SASI_Mm01_00109165 predicted 838
4 SASI_Mm01_00109166 predicted 334
5 SASI_Mm01_00109167 predicted 568
6 SASI_Mm01_00109169 predicted 1255
7 SASI_Mm01_00109170 predicted 1179
8 SASI_Mm01_00109171 predicted 1404
9 SASI_Mm01_00109172 predicted 1432
10 SASI_Mm02_00324436 predicted 828
11 SASI_Mm01_00109168 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013369
DNMT3L MISSION shRNA Bacterial Glycerol Stock
DNA (cytosine-5-)-methyltransferase 3-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013369.2-1493s1c1
Sequence:CCGGGCTCTGGTTTCGGAAGAAGAACTCGAGTTCTTCTTCCGAAACCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013369.2-1324s1c1
Sequence:CCGGCTTCTGGATGTTCGTGGACAACTCGAGTTGTCCACGAACATCCAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013369.2-608s1c1
Sequence:CCGGGTCAAGGCTAACCAGCGAAATCTCGAGATTTCGCTGGTTAGCCTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013369.2-814s1c1
Sequence:CCGGCCCTGATTGCACCCGATGCTACTCGAGTAGCATCGGGTGCAATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013369.2-1326s21c1
Sequence:CCGGTCTGGATGTTCGTGGACAATCCTCGAGGATTGTCCACGAACATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013369.2-609s21c1
Sequence:CCGGTCAAGGCTAACCAGCGAAATACTCGAGTATTTCGCTGGTTAGCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013369.2-578s21c1
Sequence:CCGGGGGACAGGCAGAGATCTTATTCTCGAGAATAAGATCTCTGCCTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013369.2-986s21c1
Sequence:CCGGTACGACCGAGAGTCGGAGAATCTCGAGATTCTCCGACTCTCGGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013369
DNMT3L MISSION shRNA shRNA Plasmid DNA
DNA (cytosine-5-)-methyltransferase 3-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013369.2-1493s1c1
Sequence:CCGGGCTCTGGTTTCGGAAGAAGAACTCGAGTTCTTCTTCCGAAACCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013369.2-1324s1c1
Sequence:CCGGCTTCTGGATGTTCGTGGACAACTCGAGTTGTCCACGAACATCCAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013369.2-608s1c1
Sequence:CCGGGTCAAGGCTAACCAGCGAAATCTCGAGATTTCGCTGGTTAGCCTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013369.2-814s1c1
Sequence:CCGGCCCTGATTGCACCCGATGCTACTCGAGTAGCATCGGGTGCAATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013369.2-1326s21c1
Sequence:CCGGTCTGGATGTTCGTGGACAATCCTCGAGGATTGTCCACGAACATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013369.2-609s21c1
Sequence:CCGGTCAAGGCTAACCAGCGAAATACTCGAGTATTTCGCTGGTTAGCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013369.2-578s21c1
Sequence:CCGGGGGACAGGCAGAGATCTTATTCTCGAGAATAAGATCTCTGCCTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013369.2-986s21c1
Sequence:CCGGTACGACCGAGAGTCGGAGAATCTCGAGATTCTCCGACTCTCGGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013369
DNMT3L MISSION shRNA Lentiviral Transduction Particles
DNA (cytosine-5-)-methyltransferase 3-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013369.2-1493s1c1
Sequence:CCGGGCTCTGGTTTCGGAAGAAGAACTCGAGTTCTTCTTCCGAAACCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013369.2-1324s1c1
Sequence:CCGGCTTCTGGATGTTCGTGGACAACTCGAGTTGTCCACGAACATCCAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013369.2-608s1c1
Sequence:CCGGGTCAAGGCTAACCAGCGAAATCTCGAGATTTCGCTGGTTAGCCTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013369.2-814s1c1
Sequence:CCGGCCCTGATTGCACCCGATGCTACTCGAGTAGCATCGGGTGCAATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013369.2-1326s21c1
Sequence:CCGGTCTGGATGTTCGTGGACAATCCTCGAGGATTGTCCACGAACATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013369.2-609s21c1
Sequence:CCGGTCAAGGCTAACCAGCGAAATACTCGAGTATTTCGCTGGTTAGCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013369.2-578s21c1
Sequence:CCGGGGGACAGGCAGAGATCTTATTCTCGAGAATAAGATCTCTGCCTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013369.2-986s21c1
Sequence:CCGGTACGACCGAGAGTCGGAGAATCTCGAGATTCTCCGACTCTCGGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019448
DNMT3L MISSION shRNA Bacterial Glycerol Stock
DNA (cytosine-5-)-methyltransferase 3-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019448.2-576s1c1
Sequence:CCGGCTGTACCAGATGCTACTGTTTCTCGAGAAACAGTAGCATCTGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019448.2-844s1c1
Sequence:CCGGGTACTAAAGAGTTTGGGCTTTCTCGAGAAAGCCCAAACTCTTTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019448.2-1086s1c1
Sequence:CCGGCTTCTGGATATTCATGGACAACTCGAGTTGTCCATGAATATCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019448.2-1270s1c1
Sequence:CCGGGAAGAGTATCTGCAAGCCCAACTCGAGTTGGGCTTGCAGATACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019448.2-436s1c1
Sequence:CCGGCCCTTGTTTGAGGGAGGGTTACTCGAGTAACCCTCCCTCAAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019448.3-625s21c1
Sequence:CCGGGGACCTCAGAGAGGATCAATGCTCGAGCATTGATCCTCTCTGAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019448.3-349s21c1
Sequence:CCGGTGATCAGGTACGAAGTCAAAGCTCGAGCTTTGACTTCGTACCTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019448.3-576s21c1
Sequence:CCGGTGTACCAGATGCTACTGTTTCCTCGAGGAAACAGTAGCATCTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019448.3-1077s21c1
Sequence:CCGGCGGCCCTTCTTCTGGATATTCCTCGAGGAATATCCAGAAGAAGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019448
DNMT3L MISSION shRNA shRNA Plasmid DNA
DNA (cytosine-5-)-methyltransferase 3-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019448.2-576s1c1
Sequence:CCGGCTGTACCAGATGCTACTGTTTCTCGAGAAACAGTAGCATCTGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019448.2-844s1c1
Sequence:CCGGGTACTAAAGAGTTTGGGCTTTCTCGAGAAAGCCCAAACTCTTTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019448.2-1086s1c1
Sequence:CCGGCTTCTGGATATTCATGGACAACTCGAGTTGTCCATGAATATCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019448.2-1270s1c1
Sequence:CCGGGAAGAGTATCTGCAAGCCCAACTCGAGTTGGGCTTGCAGATACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019448.2-436s1c1
Sequence:CCGGCCCTTGTTTGAGGGAGGGTTACTCGAGTAACCCTCCCTCAAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019448.3-625s21c1
Sequence:CCGGGGACCTCAGAGAGGATCAATGCTCGAGCATTGATCCTCTCTGAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019448.3-349s21c1
Sequence:CCGGTGATCAGGTACGAAGTCAAAGCTCGAGCTTTGACTTCGTACCTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019448.3-576s21c1
Sequence:CCGGTGTACCAGATGCTACTGTTTCCTCGAGGAAACAGTAGCATCTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019448.3-1077s21c1
Sequence:CCGGCGGCCCTTCTTCTGGATATTCCTCGAGGAATATCCAGAAGAAGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019448
DNMT3L MISSION shRNA Lentiviral Transduction Particles
DNA (cytosine-5-)-methyltransferase 3-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019448.2-576s1c1
Sequence:CCGGCTGTACCAGATGCTACTGTTTCTCGAGAAACAGTAGCATCTGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019448.2-844s1c1
Sequence:CCGGGTACTAAAGAGTTTGGGCTTTCTCGAGAAAGCCCAAACTCTTTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019448.2-1086s1c1
Sequence:CCGGCTTCTGGATATTCATGGACAACTCGAGTTGTCCATGAATATCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019448.2-1270s1c1
Sequence:CCGGGAAGAGTATCTGCAAGCCCAACTCGAGTTGGGCTTGCAGATACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019448.2-436s1c1
Sequence:CCGGCCCTTGTTTGAGGGAGGGTTACTCGAGTAACCCTCCCTCAAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019448.3-625s21c1
Sequence:CCGGGGACCTCAGAGAGGATCAATGCTCGAGCATTGATCCTCTCTGAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019448.3-349s21c1
Sequence:CCGGTGATCAGGTACGAAGTCAAAGCTCGAGCTTTGACTTCGTACCTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019448.3-576s21c1
Sequence:CCGGTGTACCAGATGCTACTGTTTCCTCGAGGAAACAGTAGCATCTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019448.3-1077s21c1
Sequence:CCGGCGGCCCTTCTTCTGGATATTCCTCGAGGAATATCCAGAAGAAGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks