EMAIL THIS PAGE TO A FRIEND

DNPEP

aspartyl aminopeptidase

82 Gene Product Result for
Synonyms: ASPEP DAP
UniProtKB ID: Q9ULA0, Q9BW44, Q9NUV5
Gene ID:
Human(23549) Summary: The protein encoded by this gene is an aminopeptidase which prefers acidic amino acids, and specifically favors aspartic acid over glutamic acid. It is thought to be a cytosolic protein involved in general metabolism of intracellular proteins. [provided by RefSeq, Jul 2008]
Mouse(13437) aspartyl aminopeptidase
Rat(301529) aspartyl aminopeptidase
Zebrafish(393122) aspartyl aminopeptidase
chicken(424200) aspartyl aminopeptidase
domestic cat(101096754) aspartyl aminopeptidase
cow(506882) aspartyl aminopeptidase
dog(478922) aspartyl aminopeptidase
sheep(101117054) aspartyl aminopeptidase
naked mole-rat(101717054) aspartyl aminopeptidase
domestic guinea pig(100721964) aspartyl aminopeptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012100 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012100 Rosetta Predictions human pricing
NM_001024879 Rosetta Predictions rat pricing
NM_001110831 Rosetta Predictions mouse pricing
NM_016878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343605 predicted 1191
2 SASI_Hs01_00154662 predicted 1299
3 SASI_Hs02_00343606 predicted 1592
4 SASI_Hs02_00343607 predicted 1583
5 SASI_Hs02_00343608 predicted 324
6 SASI_Hs02_00343609 predicted 650
7 SASI_Hs01_00154664 predicted 553
8 SASI_Hs01_00154666 predicted 1054
9 SASI_Hs02_00343610 predicted 1233
10 SASI_Hs02_00343611 predicted 1589
11 SASI_Hs01_00154660 predicted 1234
12 SASI_Hs01_00154661 predicted 202
13 SASI_Hs01_00154663 predicted 908
14 SASI_Hs01_00154665 predicted 336
15 SASI_Hs01_00154667 predicted 1361
16 SASI_Hs01_00154668 predicted 677
17 SASI_Hs01_00154669 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024879 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066097 predicted 1281
2 SASI_Rn01_00066098 predicted 359
3 SASI_Rn01_00066099 predicted 672
4 SASI_Rn01_00066101 predicted 871
5 SASI_Rn01_00066102 predicted 1135
6 SASI_Rn01_00066103 predicted 1169
7 SASI_Rn01_00066104 predicted 612
8 SASI_Rn01_00066105 predicted 1336
9 SASI_Rn01_00066106 predicted 635
10 SASI_Rn02_00202762 predicted 808
11 SASI_Rn01_00066100 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305868 predicted 1219
2 SASI_Mm02_00305869 predicted 527
3 SASI_Mm02_00305870 predicted 838
4 SASI_Mm02_00305871 predicted 774
5 SASI_Mm02_00305872 predicted 1453
6 SASI_Mm02_00305873 predicted 547
7 SASI_Mm02_00305874 predicted 1306
8 SASI_Mm02_00305875 predicted 1344
9 SASI_Mm02_00305876 predicted 708
10 SASI_Mm02_00305877 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323687 predicted 1049
2 SASI_Mm01_00030161 predicted 353
3 SASI_Mm02_00323688 predicted 666
4 SASI_Mm02_00323689 predicted 1275
5 SASI_Mm02_00323690 predicted 366
6 SASI_Mm01_00030163 predicted 1132
7 SASI_Mm02_00323691 predicted 1169
8 SASI_Mm01_00030165 predicted 1065
9 SASI_Mm02_00323692 predicted 874
10 SASI_Mm02_00323693 predicted 523
11 SASI_Mm01_00030160 predicted 450
12 SASI_Mm01_00030162 predicted 1777
13 SASI_Mm01_00030164 predicted 718
14 SASI_Mm01_00030166 predicted 861
15 SASI_Mm01_00030167 predicted 1058
16 SASI_Mm01_00030168 predicted 951
17 SASI_Mm01_00030169 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012100
VALIDATED
DNPEP MISSION shRNA Bacterial Glycerol Stock
aspartyl aminopeptidase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012100.2-1299s21c1
Sequence:CCGGGTGAACAGCAAGCAACGCTATCTCGAGATAGCGTTGCTTGCTGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012100.2-1703s21c1
Sequence:CCGGCTCTCCGTGCTACGCTTATTTCTCGAGAAATAAGCGTAGCACGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012100.2-331s21c1
Sequence:CCGGAGACTGAGAAATGGAATATTACTCGAGTAATATTCCATTTCTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012100.2-1229s21c1
Sequence:CCGGGCATCCCAACTACCTGGACAACTCGAGTTGTCCAGGTAGTTGGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012100.2-1255s21c1
Sequence:CCGGAGGAGAACCACCGGCCTTTATCTCGAGATAAAGGCCGGTGGTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012100.1-664s1c1
Sequence:CCGGGCAGCGAAATATCAACGAGAACTCGAGTTCTCGTTGATATTTCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012100.1-668s1c1
Sequence:CCGGCGAAATATCAACGAGAACTTTCTCGAGAAAGTTCTCGTTGATATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012100.1-1204s1c1
Sequence:CCGGGCATCCCAACTACCTGGACAACTCGAGTTGTCCAGGTAGTTGGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012100.1-1274s1c1
Sequence:CCGGGTGAACAGCAAGCAACGCTATCTCGAGATAGCGTTGCTTGCTGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012100.1-667s1c1
Sequence:CCGGGCGAAATATCAACGAGAACTTCTCGAGAAGTTCTCGTTGATATTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012100
VALIDATED
DNPEP MISSION shRNA shRNA Plasmid DNA
aspartyl aminopeptidase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012100.2-1299s21c1
Sequence:CCGGGTGAACAGCAAGCAACGCTATCTCGAGATAGCGTTGCTTGCTGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012100.2-1703s21c1
Sequence:CCGGCTCTCCGTGCTACGCTTATTTCTCGAGAAATAAGCGTAGCACGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012100.2-331s21c1
Sequence:CCGGAGACTGAGAAATGGAATATTACTCGAGTAATATTCCATTTCTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012100.2-1229s21c1
Sequence:CCGGGCATCCCAACTACCTGGACAACTCGAGTTGTCCAGGTAGTTGGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012100.2-1255s21c1
Sequence:CCGGAGGAGAACCACCGGCCTTTATCTCGAGATAAAGGCCGGTGGTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012100.1-664s1c1
Sequence:CCGGGCAGCGAAATATCAACGAGAACTCGAGTTCTCGTTGATATTTCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012100.1-668s1c1
Sequence:CCGGCGAAATATCAACGAGAACTTTCTCGAGAAAGTTCTCGTTGATATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012100.1-1204s1c1
Sequence:CCGGGCATCCCAACTACCTGGACAACTCGAGTTGTCCAGGTAGTTGGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012100.1-1274s1c1
Sequence:CCGGGTGAACAGCAAGCAACGCTATCTCGAGATAGCGTTGCTTGCTGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012100.1-667s1c1
Sequence:CCGGGCGAAATATCAACGAGAACTTCTCGAGAAGTTCTCGTTGATATTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012100
VALIDATED
DNPEP MISSION shRNA Lentiviral Transduction Particles
aspartyl aminopeptidase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012100.2-1299s21c1
Sequence:CCGGGTGAACAGCAAGCAACGCTATCTCGAGATAGCGTTGCTTGCTGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012100.2-1703s21c1
Sequence:CCGGCTCTCCGTGCTACGCTTATTTCTCGAGAAATAAGCGTAGCACGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012100.2-331s21c1
Sequence:CCGGAGACTGAGAAATGGAATATTACTCGAGTAATATTCCATTTCTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012100.2-1229s21c1
Sequence:CCGGGCATCCCAACTACCTGGACAACTCGAGTTGTCCAGGTAGTTGGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012100.2-1255s21c1
Sequence:CCGGAGGAGAACCACCGGCCTTTATCTCGAGATAAAGGCCGGTGGTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012100.1-664s1c1
Sequence:CCGGGCAGCGAAATATCAACGAGAACTCGAGTTCTCGTTGATATTTCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012100.1-668s1c1
Sequence:CCGGCGAAATATCAACGAGAACTTTCTCGAGAAAGTTCTCGTTGATATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012100.1-1204s1c1
Sequence:CCGGGCATCCCAACTACCTGGACAACTCGAGTTGTCCAGGTAGTTGGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012100.1-1274s1c1
Sequence:CCGGGTGAACAGCAAGCAACGCTATCTCGAGATAGCGTTGCTTGCTGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012100.1-667s1c1
Sequence:CCGGGCGAAATATCAACGAGAACTTCTCGAGAAGTTCTCGTTGATATTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016878
VALIDATED
DNPEP MISSION shRNA Bacterial Glycerol Stock
aspartyl aminopeptidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016878.2-813s1c1
Sequence:CCGGGCGAAATATCAATGAGAACTTCTCGAGAAGTTCTCATTGATATTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016878.2-461s1c1
Sequence:CCGGGCTGGGATATCGTACCAGAAACTCGAGTTTCTGGTACGATATCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016878.2-1544s1c1
Sequence:CCGGCCATTGGACCTATCTTGGCTTCTCGAGAAGCCAAGATAGGTCCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016878.2-1354s1c1
Sequence:CCGGCCAAACTACTCGGACAAGCATCTCGAGATGCTTGTCCGAGTAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016878.2-713s1c1
Sequence:CCGGGCGTCATTATCAAGTGCCCTACTCGAGTAGGGCACTTGATAATGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016878
VALIDATED
DNPEP MISSION shRNA shRNA Plasmid DNA
aspartyl aminopeptidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016878.2-813s1c1
Sequence:CCGGGCGAAATATCAATGAGAACTTCTCGAGAAGTTCTCATTGATATTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016878.2-461s1c1
Sequence:CCGGGCTGGGATATCGTACCAGAAACTCGAGTTTCTGGTACGATATCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016878.2-1544s1c1
Sequence:CCGGCCATTGGACCTATCTTGGCTTCTCGAGAAGCCAAGATAGGTCCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016878.2-1354s1c1
Sequence:CCGGCCAAACTACTCGGACAAGCATCTCGAGATGCTTGTCCGAGTAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016878.2-713s1c1
Sequence:CCGGGCGTCATTATCAAGTGCCCTACTCGAGTAGGGCACTTGATAATGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016878
VALIDATED
DNPEP MISSION shRNA Lentiviral Transduction Particles
aspartyl aminopeptidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016878.2-813s1c1
Sequence:CCGGGCGAAATATCAATGAGAACTTCTCGAGAAGTTCTCATTGATATTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016878.2-461s1c1
Sequence:CCGGGCTGGGATATCGTACCAGAAACTCGAGTTTCTGGTACGATATCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016878.2-1544s1c1
Sequence:CCGGCCATTGGACCTATCTTGGCTTCTCGAGAAGCCAAGATAGGTCCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016878.2-1354s1c1
Sequence:CCGGCCAAACTACTCGGACAAGCATCTCGAGATGCTTGTCCGAGTAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016878.2-713s1c1
Sequence:CCGGGCGTCATTATCAAGTGCCCTACTCGAGTAGGGCACTTGATAATGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)