EMAIL THIS PAGE TO A FRIEND

DNPH1

2'-deoxynucleoside 5'-phosphate N-hydrolase 1

82 Gene Product Result for
Synonyms: C6orf108 RCL RP3-330M21.3 dJ330M21.3
UniProtKB ID: O43598, B2LUJ9
Gene ID:
Human(10591) Summary: This gene was identified on the basis of its stimulation by c-Myc protein. The latter is a transcription factor that participates in the regulation of cell proliferation, differentiation, and apoptosis. The exact function of this gene is not known but studies in rat suggest a role in cellular proliferation and c-Myc-mediated transformation. Two alternative transcripts encoding different proteins have been described. [provided by RefSeq, Jul 2008]
Mouse(381101) 2'-deoxynucleoside 5'-phosphate N-hydrolase 1
Rat(171047) 2'-deoxynucleoside 5'-phosphate N-hydrolase 1
domestic guinea pig(100715431) 2'-deoxynucleoside 5'-phosphate N-hydrolase 1
naked mole-rat(101717635) 2'-deoxynucleoside 5'-phosphate N-hydrolase 1
Zebrafish(561810) 2'-deoxynucleoside 5'-phosphate N-hydrolase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207161 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207161 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207161 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006443 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006443 Rosetta Predictions human pricing
NM_199184 Rosetta Predictions human pricing
NM_133525 Rosetta Predictions rat pricing
NM_207161 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086860 predicted 384
2 SASI_Hs02_00341577 predicted 299
3 SASI_Hs01_00086861 predicted 224
4 SASI_Hs02_00341578 predicted 274
5 SASI_Hs01_00086862 predicted 367
6 SASI_Hs01_00086863 predicted 330
7 SASI_Hs01_00086864 predicted 300
8 SASI_Hs01_00086865 predicted 301
9 SASI_Hs01_00086867 predicted 372
10 SASI_Hs01_00086868 predicted 375
11 SASI_Hs01_00086866 predicted 341
12 SASI_Hs01_00086869 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163077 predicted 306
2 SASI_Hs01_00163078 predicted 225
3 SASI_Hs01_00163079 predicted 407
4 SASI_Hs01_00163080 predicted 328
5 SASI_Hs02_00372633 predicted 498
6 SASI_Hs01_00163081 predicted 269
7 SASI_Hs01_00163082 predicted 335
8 SASI_Hs01_00163083 predicted 334
9 SASI_Hs01_00163084 predicted 295
10 SASI_Hs01_00163085 predicted 298
11 SASI_Hs01_00163076 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099419 predicted 306
2 SASI_Rn01_00099420 predicted 305
3 SASI_Rn01_00099421 predicted 273
4 SASI_Rn01_00099422 predicted 269
5 SASI_Rn01_00099423 predicted 197
6 SASI_Rn01_00099424 predicted 270
7 SASI_Rn01_00099425 predicted 196
8 SASI_Rn01_00099426 predicted 273
9 SASI_Rn01_00099427 predicted 299
10 SASI_Rn01_00099428 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351910 predicted 620
2 SASI_Mm02_00351911 predicted 576
3 SASI_Mm02_00351912 predicted 552
4 SASI_Mm02_00351913 predicted 632
5 SASI_Mm02_00351914 predicted 431
6 SASI_Mm02_00351915 predicted 678
7 SASI_Mm02_00351916 predicted 437
8 SASI_Mm01_00197357 predicted 242
9 SASI_Mm01_00197358 predicted 269
10 SASI_Mm02_00351917 predicted 411
11 SASI_Mm01_00197353 predicted 240
12 SASI_Mm01_00197354 predicted 271
13 SASI_Mm01_00197355 predicted 233
14 SASI_Mm01_00197356 predicted 300
15 SASI_Mm01_00197359 predicted 218
16 SASI_Mm01_00197360 predicted 322
17 SASI_Mm01_00197361 predicted 314
18 SASI_Mm01_00197362 predicted 301
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207161
DNPH1 MISSION shRNA Bacterial Glycerol Stock
2'-deoxynucleoside 5'-phosphate N-hydrolase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207161.1-349s1c1
Sequence:CCGGCCGAGTGCTTTCCGCCATGATCTCGAGATCATGGCGGAAAGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207161.1-401s1c1
Sequence:CCGGGTGTGGGACTACGCAGAGGAACTCGAGTTCCTCTGCGTAGTCCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207161.1-301s1c1
Sequence:CCGGAGTAGCTCTTGGTAAGCCGATCTCGAGATCGGCTTACCAAGAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207161.1-87s1c1
Sequence:CCGGCTCTGTATTCGCGGATCGTATCTCGAGATACGATCCGCGAATACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207161.1-236s1c1
Sequence:CCGGGCCGATGTGGTCGTGGCAGAACTCGAGTTCTGCCACGACCACATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207161.3-98s21c1
Sequence:CCGGCTCTGTATTCGCGGATCGTATCTCGAGATACGATCCGCGAATACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207161.3-360s21c1
Sequence:CCGGCCGAGTGCTTTCCGCCATGATCTCGAGATCATGGCGGAAAGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207161.3-412s21c1
Sequence:CCGGGTGTGGGACTACGCAGAGGAACTCGAGTTCCTCTGCGTAGTCCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207161
DNPH1 MISSION shRNA shRNA Plasmid DNA
2'-deoxynucleoside 5'-phosphate N-hydrolase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207161.1-349s1c1
Sequence:CCGGCCGAGTGCTTTCCGCCATGATCTCGAGATCATGGCGGAAAGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207161.1-401s1c1
Sequence:CCGGGTGTGGGACTACGCAGAGGAACTCGAGTTCCTCTGCGTAGTCCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207161.1-301s1c1
Sequence:CCGGAGTAGCTCTTGGTAAGCCGATCTCGAGATCGGCTTACCAAGAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207161.1-87s1c1
Sequence:CCGGCTCTGTATTCGCGGATCGTATCTCGAGATACGATCCGCGAATACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207161.1-236s1c1
Sequence:CCGGGCCGATGTGGTCGTGGCAGAACTCGAGTTCTGCCACGACCACATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207161.3-98s21c1
Sequence:CCGGCTCTGTATTCGCGGATCGTATCTCGAGATACGATCCGCGAATACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207161.3-360s21c1
Sequence:CCGGCCGAGTGCTTTCCGCCATGATCTCGAGATCATGGCGGAAAGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207161.3-412s21c1
Sequence:CCGGGTGTGGGACTACGCAGAGGAACTCGAGTTCCTCTGCGTAGTCCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207161
DNPH1 MISSION shRNA Lentiviral Transduction Particles
2'-deoxynucleoside 5'-phosphate N-hydrolase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207161.1-349s1c1
Sequence:CCGGCCGAGTGCTTTCCGCCATGATCTCGAGATCATGGCGGAAAGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207161.1-401s1c1
Sequence:CCGGGTGTGGGACTACGCAGAGGAACTCGAGTTCCTCTGCGTAGTCCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207161.1-301s1c1
Sequence:CCGGAGTAGCTCTTGGTAAGCCGATCTCGAGATCGGCTTACCAAGAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207161.1-87s1c1
Sequence:CCGGCTCTGTATTCGCGGATCGTATCTCGAGATACGATCCGCGAATACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207161.1-236s1c1
Sequence:CCGGGCCGATGTGGTCGTGGCAGAACTCGAGTTCTGCCACGACCACATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207161.3-98s21c1
Sequence:CCGGCTCTGTATTCGCGGATCGTATCTCGAGATACGATCCGCGAATACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207161.3-360s21c1
Sequence:CCGGCCGAGTGCTTTCCGCCATGATCTCGAGATCATGGCGGAAAGCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207161.3-412s21c1
Sequence:CCGGGTGTGGGACTACGCAGAGGAACTCGAGTTCCTCTGCGTAGTCCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006443
VALIDATED
DNPH1 MISSION shRNA Bacterial Glycerol Stock
2'-deoxynucleoside 5'-phosphate N-hydrolase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006443.2-480s1c1
Sequence:CCGGGATCGATACTTCGAGGCTGATCTCGAGATCAGCCTCGAAGTATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006443.2-432s1c1
Sequence:CCGGCGGTTCCAGGTGTGGGACTATCTCGAGATAGTCCCACACCTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006443.2-389s1c1
Sequence:CCGGCCGCGTGCTTTCGGCCATGATCTCGAGATCATGGCCGAAAGCACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006443.2-83s1c1
Sequence:CCGGCCTGTACTTCTGCGGGAGCATCTCGAGATGCTCCCGCAGAAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006443.2-305s1c1
Sequence:CCGGGCCATCCTTGGGTGTAGGCTACTCGAGTAGCCTACACCCAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006443.2-83s21c1
Sequence:CCGGCCTGTACTTCTGCGGGAGCATCTCGAGATGCTCCCGCAGAAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006443.2-389s21c1
Sequence:CCGGCCGCGTGCTTTCGGCCATGATCTCGAGATCATGGCCGAAAGCACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006443.2-432s21c1
Sequence:CCGGCGGTTCCAGGTGTGGGACTATCTCGAGATAGTCCCACACCTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006443.2-480s21c1
Sequence:CCGGGATCGATACTTCGAGGCTGATCTCGAGATCAGCCTCGAAGTATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006443.2-305s21c1
Sequence:CCGGGCCATCCTTGGGTGTAGGCTACTCGAGTAGCCTACACCCAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006443
VALIDATED
DNPH1 MISSION shRNA shRNA Plasmid DNA
2'-deoxynucleoside 5'-phosphate N-hydrolase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006443.2-480s1c1
Sequence:CCGGGATCGATACTTCGAGGCTGATCTCGAGATCAGCCTCGAAGTATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006443.2-432s1c1
Sequence:CCGGCGGTTCCAGGTGTGGGACTATCTCGAGATAGTCCCACACCTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006443.2-389s1c1
Sequence:CCGGCCGCGTGCTTTCGGCCATGATCTCGAGATCATGGCCGAAAGCACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006443.2-83s1c1
Sequence:CCGGCCTGTACTTCTGCGGGAGCATCTCGAGATGCTCCCGCAGAAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006443.2-305s1c1
Sequence:CCGGGCCATCCTTGGGTGTAGGCTACTCGAGTAGCCTACACCCAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006443.2-83s21c1
Sequence:CCGGCCTGTACTTCTGCGGGAGCATCTCGAGATGCTCCCGCAGAAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006443.2-389s21c1
Sequence:CCGGCCGCGTGCTTTCGGCCATGATCTCGAGATCATGGCCGAAAGCACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006443.2-432s21c1
Sequence:CCGGCGGTTCCAGGTGTGGGACTATCTCGAGATAGTCCCACACCTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006443.2-480s21c1
Sequence:CCGGGATCGATACTTCGAGGCTGATCTCGAGATCAGCCTCGAAGTATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006443.2-305s21c1
Sequence:CCGGGCCATCCTTGGGTGTAGGCTACTCGAGTAGCCTACACCCAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006443
VALIDATED
DNPH1 MISSION shRNA Lentiviral Transduction Particles
2'-deoxynucleoside 5'-phosphate N-hydrolase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006443.2-480s1c1
Sequence:CCGGGATCGATACTTCGAGGCTGATCTCGAGATCAGCCTCGAAGTATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006443.2-432s1c1
Sequence:CCGGCGGTTCCAGGTGTGGGACTATCTCGAGATAGTCCCACACCTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006443.2-389s1c1
Sequence:CCGGCCGCGTGCTTTCGGCCATGATCTCGAGATCATGGCCGAAAGCACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006443.2-83s1c1
Sequence:CCGGCCTGTACTTCTGCGGGAGCATCTCGAGATGCTCCCGCAGAAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006443.2-305s1c1
Sequence:CCGGGCCATCCTTGGGTGTAGGCTACTCGAGTAGCCTACACCCAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006443.2-83s21c1
Sequence:CCGGCCTGTACTTCTGCGGGAGCATCTCGAGATGCTCCCGCAGAAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006443.2-389s21c1
Sequence:CCGGCCGCGTGCTTTCGGCCATGATCTCGAGATCATGGCCGAAAGCACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006443.2-432s21c1
Sequence:CCGGCGGTTCCAGGTGTGGGACTATCTCGAGATAGTCCCACACCTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006443.2-480s21c1
Sequence:CCGGGATCGATACTTCGAGGCTGATCTCGAGATCAGCCTCGAAGTATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006443.2-305s21c1
Sequence:CCGGGCCATCCTTGGGTGTAGGCTACTCGAGTAGCCTACACCCAAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks